1 / 35

GBIO0009-1 Bioinformatics

GBIO0009-1 Bioinformatics. Introduction to DB. Instructors. Practical sessions Kyrylo Bessonov (Kirill) Office: B37 1/16 kbessonov@ulg.ac.be Office hours: by appointment. Overview. Introduction to public databases Databases demo HW The submission system. What are we looking for?.

nilsen
Download Presentation

GBIO0009-1 Bioinformatics

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. GBIO0009-1 Bioinformatics Introduction to DB

  2. Instructors • Practical sessions KyryloBessonov (Kirill) • Office: B37 1/16 • kbessonov@ulg.ac.be • Office hours: by appointment

  3. Overview • Introduction to public databases • Databases demo HW • The submission system

  4. What are we looking for? Data & databases

  5. Biologists Collect Lots of Data • Hundreds of thousands of species to explore • Millions of written articles in scientific journals • Detailed genetic information: • gene names • phenotype of mutants • location of genes/mutations on chromosomes • linkage (distances between genes) • High Throughput lab technologies • PCR • Rapid inexpensive DNA sequencing (Illumina HiSeq) • Microarrays (Affymetrix) • Genome-wide SNP chips / SNP arrays (Illumina) • Must store data such that • Minimum data quality is checked • Well annotated according to standards • Made available to wide public to foster research

  6. What is database? • Organized collection of data • Information is stored in "records“, "fields“, “tables” • Fields are categories • Must contain data of the same type (e.g. columns below) • Records contain data that is related to one object (e.g. protein, SNP) (e.g. rows below)

  7. Genome sequencing generates lots of data

  8. Biological Databases The number of databases is constantly growing!-OBRC: Online Bioinformatics Resources Collection currently lists over 2826databases (2013)

  9. Main databases by category • Literature • PubMed: scientific & medical abstracts/citations • Health • OMIM: online mendelian inheritance in man • Nucleotide Sequences • Nucleotide: DNA and RNA sequences • Genomes • Genome: genome sequencing projects by organism • dbSNP: short genetic variations • Genes • Protein: protein sequences • UniProt: protein sequences and related information • Chemicals • PubChem Compound: chemical information with structures, information and links • Pathways • BioSystems: molecular pathways with links to genes, proteins • KEGG Pathway: information on main biological pathways

  10. Growth of UniProtKB database • UniProtKB contains mainly protein sequences (entries). The database growth is exponential • Data management issues? (e.g. storage, search, indexing?) number of entries Source: http://www.ebi.ac.uk/uniprot/TrEMBLstats

  11. Primary and Secondary Databases • Primary databases • REAL EXPERIMENTAL DATA (raw) • Biomolecular sequences or structures and associatedannotationinformation (organism, function, mutation linked to disease,functional/structural patterns, bibliographic etc.) • Secondary databases • DERIVED INFORMATION (analyzed and annotated) • Fruits of analyses of primary data in the primary sources(patterns, blocks, profiles etc. which representthe most conserved features of multiple alignments)

  12. Primary Databases • Sequence Information • DNA: EMBL, Genbank, DDBJ • Protein: SwissProt, TREMBL, PIR, OWL • Genome Information • GDB, MGD, ACeDB • Structure Information • PDB, NDB, CCDB/CSD

  13. Secondary Databases • Sequence-related Information • ProSite, Enzyme, REBase • Genome-related Information • OMIM, TransFac • Structure-related Information • DSSP, HSSP, FSSP, PDBFinder • Pathway Information • KEGG, Pathways

  14. GenBank database • Contains all DNA and protein sequences described in the scientific literature or collected in publicly funded research • One can search by protein name to get DNA/mRNA sequences • The search results could be filtered by species and other parameters

  15. GenBank main fields

  16. NCBI Databases contain more than just DNA & protein sequences NCBI main portal: http://www.ncbi.nlm.nih.gov/

  17. Fasta format to store sequences • The FASTA format is now universal for all databases and software that handles DNA and protein sequences • Specifications: • One header line • starts with > with a ends with [return] • Saccharomyces cerevisiae strain YC81 actin (ACT1) gene • GenBank: JQ288018.1 • >gi|380876362|gb|JQ288018.1| Saccharomyces cerevisiae strain YC81 actin (ACT1) gene, partial cds TGGCATCATACCTTCTACAACGAATTGAGAGTTGCCCCAGAAGAACACCCTGTTCTTTTGACTGAAGCTCCAATGAACCCTAAATCAAACAGAGAAAAGATGACTCAAATTATGTTTGAAACTTTCAACGTTCCAGCCTTCTACGTTTCCATCCAAGCCGTTTTGTCCTTGTACTCTTCCGGTAGAACTACTGGTATTGTTTTGGATTCCGGTGATGGTGTTACTCACGTCGTTCCAATTTACGCTGGTTTCTCTCTACCTCACGCCATTTTGAGAATCGATTTGGCCGGTAGAGATTTGACTGACTACTTGATGAAGATCTTGAGTGAACGTGGTTACTCTTTCTCCACCACTGCTGAAAGAGAAATTGTCCGTGACATCAAGGAAAAACTATGTTACGTCGCCTTGGACTTCGAGCAAGAAATGCAAACCGCTGCTCAATCTTCTTCAATTGAAAAATCCTACGAACTTCCAGATGGTCAAGTCATCACTATTGGTAAC

  18. OMIM database • Online Mendelian Inheritance in Man (OMIM) •  ”information on all known mendelian disorders linked to over 12,000 genes” • “Started at 1960s by Dr. Victor A. McKusick as a catalog of mendelian traits and disorders” • Linked disease data • Links disease phenotypes and causative genes • Used by physicians and geneticists

  19. OMIM – basic search • Online Tutorial: http://www.openhelix.com/OMIM • Each search results entry has *, +, # or % symbol • # entries are the most informative as molecular basis of phenotype – genotype association is known is known • Will do search on: Ankylosing spondylitis (AS) • AS characterized by chronic inflammation of spine

  20. OMIM-search results • Look for the entires that link to the genes. Apply filters if needed Filter results if known SNP is associated to the entry Some of the interesting entries. Try to look for the ones with # sign

  21. OMIM-entries

  22. OMIM Gene ID -entries

  23. OMIM-Finding disease linked genes • Read the report of given top gene linked phenotype • Mapping – Linkage heterogeneity section • Go back to the original results • Previously seen entry *607562 – IL23R

  24. PubMed database • PubMed is one of the best known database in the whole scientific community • Most of biology related literature from all the related fields are being indexed by this database • It has very powerful mechanism of constructing search queries • Many search fields ● Logical operatiors (AND, OR) • Provides electronic links to most journals • Example of searching by author articles published within 2012-2013

  25. References • [1] Durinck, Steffen, et al. "BioMart and Bioconductor: a powerful link between biological databases and microarray data analysis." Bioinformatics 21.16 (2005): 3439-3440. • [2] Hamosh, Ada, et al. "Online Mendelian Inheritance in Man (OMIM), a knowledgebase of human genes and genetic disorders." Nucleic acids research30.1 (2002): 52-55. • [3] Ihaka, Ross, and Robert Gentleman. "R: a language for data analysis and graphics." Journal of computational and graphical statistics 5.3 (1996): 299-314.

  26. Demo homework Exploring OMIM and PubMed databases

  27. Demo HW assignment (1) Question 1: Inherited Disease Genes In this question, you will choose a human disease and find the GenBank accession numbers and sequences of some genes which are thought to affect it. • Go to the OMIM database: http://www.ncbi.nlm.nih.gov/omim • Perform a search for a human disease you are interested in. Some possibilities include: Leukaemia, Breast cancer, Crohn, IBD. You can choose any other disease • Print the first page of the search results and circle two results in the printout which you will use to find related to the disease nucleotide sequences (i.e. genes). (Not every item in the search results is related/linked to a sequence)

  28. Demo HW assignment (2) • For each of the two circled entries, follow the links to a GenBank database(Note that some of the sequences you will see in the first list may not be human.) • Display the chosen nucleotide sequences of the disease-related genes in FASTA format as Plain Text and copy&paste it below (only the 1st 5 lines, do not copy whole FASTA file)

  29. Demo HW assignment (3) Question 2: Medical Articles In this question, you will search for articles on your chosen disease and restrict your search in various ways. • Go to the PubMed database: http://www.ncbi.nlm.nih.gov/pubmed • Perform a search for the same human disease as you used for OMIM. Write down how many articles are out there? Provide below the search key word(s) used to obtain the results • Perform the same search, only for articles which appeared exactly within the 2013 year. How many did you found? Provide below the exact query search key words used to obtain the results (e.g. ([Author] …) AND ([Journal] …) ) and or graphical explanation on how the publication date filter was applied • Print the Abstracts of the first 5 search results

  30. AssignmentSubmission Step by Step Guide

  31. Assignment submission • All assignments should be zipped into one file (*.zip) and submitted online • Create a submission account

  32. Account creation • Any member of the group can submit assignment • Account details will be emailed to you automatically • All GBIO009-1 students should create an account

  33. Submit your assignment • After account creation login into a submission page • The remaining time to deadline is displayed. Good idea to check it from time to time in order to be on top of things • File extension should be zip • Can submit assignment as many times as you wish

  34. Next class bring PC for R installation! Next class form groups of 2-3 persons to work on HW

More Related