J 1 Characterization of clones

Section JAnalysis and Uses of Cloned DNAJ 1 Characterization of clones J 2 Nucleic Acid Sequencing J 3 Polymerase chain reaction J 4 Organization of cloned genes J 5 Mutagenesis of cloned genes J 6 Applications of cloning Yang Xu, College of Life Sciences

J 1 Characterization of clones • Characterization • Restriction mapping • Partial digestion • Labeling nucleic acid • Southern and northern blotting Yang Xu, College of Life Sciences

Characterization This process of characterizing a genomic or cDNA clone include: the size, restriction map, transcribed sequence, position, polarity and  the sequencing of the insert DNA. More experiments must be performed to verify that: • Predicted gene is actually transcribed into mRNA in some cells; • A expression gene: a predicted-size protein may be made in vivo; Yang Xu, College of Life Sciences

Sal1 S Sal1 S 19 kb 15 kb 9 kb H HindIII H HindIII HindIII H 21 kb 7 kb 11 kb 4kb 2kb 6kb 5kb Restriction mapping • Size: The insert can be determined by agarose gel electrophoresis using markers. It is best to digest the DNA with arestriction enzyme • Orientation of the insert: It can be determined by digesting with two restriction enzymes. Fig. la illustrates the process for a EMBL3 genomic clone. (long arm+insert+short arm) Sal I Hand III Sal I + Hand III Yang Xu, College of Life Sciences

1k 2kb 4kb 3kb E E E 10kb 6kb 4kb 3kb 2kb 1kb Partial digestion 1. End-labeled DNA: Adding a radioactive nucleotide to one end of the DNA fragment producing an end-labeled molecule. 2. Total digestion of the unlabeled 10kb fragment with EcoRI gives 1, 2, 3 and 4kb pieces. 3. Partial digestion, with low EcoRI concentration, which can generate all possible fragments, shows additional bands of 6, 7 and 10 kb. Note 3, 4 and 6 kb can be generated in more than one way. Total Partial Auto-radio 4. Auto-radiographed: if the partial digestion lane is auto-radiographed to show up only those end-labeled molecules, the pattern is 3, 4, 6 and 10 kb. This allows the map shown (size and orientation). Yang Xu, College of Life Sciences

Labeling nucleic acid Classification: DNA and RNA molecules can either be labeled: • End labeling: labeling at their ends • 5'-End labeling: using polynucleotide kinase to add a radioactive phosphate to 5’-end of nucleic acids. • 3'-End labeling:  using terminal transferase to add one or more nucleotides to the 3’-end of nucleic acids or  using polymerases to “fill in” the 3'-end with [-32P] dCTP. Yang Xu, College of Life Sciences

Labeling nucleic acid • Uniform labeling: throughout the fragments • dsDNA is treated with a tiny amount of DNase I, which introduces random nicks along both strands. DNA polymerase I can find these nicks and remove dNTPs, then incorporate radioactive nucleotides. • Strand-specific labeling: one strand of the dsDNA. • Strand-specific DNA probes: for example, using single-stranded DNA obtained after cloning in an M13 phage vector; • Strand-specific RNA probes: using RNA polymerases such as SP6, T7 or T3 phage polymerases (see Topic H1). Yang Xu, College of Life Sciences

Southern and northern blotting-I Function and Name:Using labeled probe to hybridize and detect which DNA (or RNA) molecule on an agarose gel. Southern blots is for DNA and Northern blots is for RNA. The former is named after its inventor and the latter was named from the former one. • Procedure: • 1. Agarose gel electrophoresis: to separate the nucleic acid molecules; • 2. Denatured with alkali:only for DNA; • 3. Transfer: then transferred the molecules to a nylon or nitrocellulose membrane. This is done by  capillary action,  electrotransfer,  vacuum transfer; • 4. Hybridization: the nucleic acid must be hybridized to labeled probe; • 5. Washing and baking: washing extensively and baking • 6. Detection: usually by auto-radiography or antibody methods Yang Xu, College of Life Sciences

Southern and northern blotting-II Definition: The stringency is stability of the hybridized molecules. If the probe and target gene are 100% complementary in sequence, then we say this is a high stringency hybridization. • High stringency:high temperature and low salt is more stringent, as only perfectly matched hybrids will be stable; • Low stringency:If the stringency is too low, then the probe may lose its specialty, and bind to too many sequences. • Washing temperature: Washing step should be carried out at 12C below the theoretical melting temperature (Tm) of the probe and target sequences, using the formula: • Tm = 69.3C + 0.41 [% (G + C)] – 650/L • where L is the length of the probe molecule. Yang Xu, College of Life Sciences

Southern and northern blotting-III Southern blots: to find which parts of the genomic clone match a cDNA probe; If the Southern blot contains genomic DNA fragments from the whole genome, the probe will give information about the size of the fragment; and how many copies of the gene are present in the genome. Northern blots: to find the size of the mRNA and any precursors; to determine if a cDNA clone used as a probe is full-length; to determine if it is a family member of related transcripts; to identify if a genomic clone has regions transcribed; to find where these transcripts are made (what tissues the RNA is from). Yang Xu, College of Life Sciences

J 2 Nucleic Acid Sequencing • The two main methods of DNA sequencing are (1) Maxam’s method: the end-labeled DNA is subjected to base-specific cleavage reactions prior to gel separation; (2) Sanger’s method: to uses di-dNTP as chain terminators to produce a ladder of molecules generated by polymerase extension of a primer. • A set of four RNases that cleave 3' to specific nucleotides are used to produce a ladder of fragments from end-labeled RNA. The PAGE analysis allows the sequence to be read. • Newly determined DNA, RNA and protein sequences are entered into databases (EMBL and GenBank). • Special computer software is used to search nucleic acid and protein sequences for the presence of patterns (e.g. restriction mapping). • The entire genome sequences of several organisms have been determined (viruses, bacteria and yeast, some plants and human). Often a genetic map is first produced to aid the project. Yang Xu, College of Life Sciences

J 3 Polymerase chain reaction • PCR • The PCR cycle • Template • Primers • Enzymes Yang Xu, College of Life Sciences

PCR Definition: If a pair of oligo-nucleotide primers can be designed to be complementary to a target DNA molecule such that they can be extended by a DNA polymerase towards each other, then the template bounded by the primers can be greatly amplified by carrying out cycles of denaturation, primer annealing and polymerization. This process is known as the polymerase chain reaction (PCR). The discovery of thermostable DNA polymerases has made the steps in the PCR cycle much more convenient. Yang Xu, College of Life Sciences

Template Primers Taq polymerase The PCR cycle • Denaturation: 95C (60s); • Annealing: 55C (30s) • Polymerization: 72C (60-90s) which will use up dNTPs in the reaction mix and requires Mg2+. Yang Xu, College of Life Sciences

The PCR cycle • Molecules with correct length; • At the end of cycle 2, see Fig.1, some newly synthesized molecules with correct length exist. In subsequent cycles, these soon outnumber the original target molecules and increase two-fold with each cycle. • If PCR was 100% efficient, one pair of template, PCR with 20 cycles are as an example:  Molecules withnon-correct length: 20 ×2 = 40 ssDNA;  Molecules withcorrect length: 220 - 40 = 2,097,112 Yang Xu, College of Life Sciences

Template • Number of the templates: It has been demonstrated that PCR can sometimes amplify as little as one molecule of starting template. • Source of the template: In principle, any source of DNA that provides one or more target molecules can be used as a template for PCR. This includes DNA prepared: • from blood, sperm or any other tissue; • from older forensic specimens; • from ancient biological samples; • in the laboratory from bacterial colonies or phage plaques as well as purified DNA. • Requirement of the template: Whatever the source of template DNA, PCR can only be applied if some sequence information is known in advance so that primers can be designed. Yang Xu, College of Life Sciences

Primers • Requirements of PCR primers:  They need to be about 18-30 nt long and  to have similar G+C contents so that they anneal to complementary sequences at similar temperatures. • Length of target sequences:  Short target sequences amplify more easily, so often this distance is less than 500 bp, but, with optimization, PCR can amplify fragments over 10 kb in length. • Primer design: • The region to be amplified should be inspected for two sequences of  about 20 nt with a  similar G+C content; • If the PCR product is used to cloning, the primers had better include the same restriction sites within the 5'-ends. • They are designed to anneal on opposite strands of the target sequence so that they will be extended towards each other by addition of nucleotides to their 3'-ends. Yang Xu, College of Life Sciences

Enzymes Source: Thermo-stable DNA polymerases which have been isolated and cloned from a number of thermo-philic bacteria are used for PCR. Taq polymerase: The most common is Taq polymerase from Thermus aquaticus. • Feature: It survives during the denaturation step at 95 C for 1-2 min, having a half-life of more than 2 h at this temperature. • Disadvantages: Because it lacks 3' to 5' proofreading exonuclease activity (see Topics F1 and G1, Table1), Taq polymerase is known to introduce errors when it copies DNA roughly one per 250 nt polymerized. For this reason, other thermostable DNA polymerases with greater accuracy are used for certain applications. Yang Xu, College of Life Sciences

J 4 Organization of cloned genes • Organization • Mapping cDNA on genomic DNA • Primer extension • DNase I footprinting • Reporter gene Yang Xu, College of Life Sciences

cDNA Organization Organization: cDNA clones have a defined organization, especially those synthesized using oligo (dT) as primer. • Start codon: If the cDNA clone is complete, it must have an ATG start codon; • ORF: Open reading frame (ORF); • A residues: Usually a run of A residues is present at cDNA 3'-end; • Stop codon for transcription; • Regulate sequences of transcription. Absent Sequences of the cDNA organization: • Introns; • Sequences upstream of the transcription start site; • Sequences downstream of the 3‘-processing site. Yang Xu, College of Life Sciences

Mapping cDNA on genomic DNA Southern blotting: If restriction maps are available for both the genomic and its cDNA clones, an important experiment is to run a Southern blot using all or part of the cDNA as a probe. Using all cDNA as probe: will showwhich genomic restriction fragments contain sequences also present in the cDNA.  These cDNAs may not be adjacent fragments in the restriction map if large introns are present. Using one end of a cDNA as a probe: will indicate  The polarity of the gene in the genomic clone.  Some restriction sites are common in both clones but may be different distances apart. These can often help to determine the organization of the genomic clone. Yang Xu, College of Life Sciences

RNA preparation 5’ DNA primer Primer extension Purpose: This technique can determine the length of the 5'- and 3'-end of RNA transcripts. Procedure: (p156 Fig. 2) 1. RNA-DNA hybridization: The probe is an antisense DNA. Annealing DNA primer, to form the RNA-DNA hybrids. 2. Primer extension: Using reverse transcriptase to extend the DNA primer in the 5' to 3' direction, from the site where it base-pairs on the target to where the polymerase dissociates at the end of the template. 3. PAGE analysis: The primer extension product is run on a gel next to size markers and/or a sequence ladder from which its length can be established. Polymerase + dNTP PAGE analysis Yang Xu, College of Life Sciences

DNase I footprinting Problem and solution:  Although gel analysis shows that a protein is binding to a DNA, it does not provide the sequence information of the binding site.  DNase footprinting shows the actual region of sequence with which the protein bends. 1. End-labeled DNA 2. Protein binding 3. DNase I partial digestion 4. PAGE Analysis 5. Auto-radiography - DNA binding Protein + DNA binding Protein Yang Xu, College of Life Sciences

Reporter gene Purpose: This technique can test if the promoter works or not. Mechanism: When the promoter has been identified by sequencing, Sl mapping and/ or DNA-protein binding experiments, it is common to attach the promoter region to a reporter gene, to study its action and verify that the promoter has the properties being ascribed to it. Yang Xu, College of Life Sciences

J 5 Mutagenesis of cloned genes • Deletion mutagenesis • Site-directed mutagenesis • PCR mutanenesis Yang Xu, College of Life Sciences

EcoRI SacI KpnI BamHI XbaISalI PstI SphI HindIII XmaI GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT MCS GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT GAATTCG CTTAAGCTCGAGCCATGGGCCCCTAGGAGATCTCAGCTGGACGTCCGTACGTTCGAA CTTAAGCTCGAGCCATGGGCCCCTAGGAGATCTCAGCTGGACGTCCGTACGTTCGAA CTTAAGC Deletion mutagenesis • Progressively deleting DNA from one end is very useful for finding the function of particular sequences. CTTAAGCTCGAGCCATGGGCCCCTAGGAGATCTCAGCTGGACGTCCGTACGTTCGAA insertion SacI and bamH1 Transcription and expression Yang Xu, College of Life Sciences

Site-directed mutagenesis Function: It is veryuseful to be able to change just one, or a few specific nucleotides in a sequence to test a hypothesis. Suspected amino acids in a protein could be changed by altering the cDNA sequence so that by a one nucleotide change an amino acid, the effect is examined by testing the function of the mutant protein. Methods: Single-stranded template: Originally, site-directed mutagenesis used this method (it was created by subcloning in M13) and a primer oligonucleotide with the desired mutation in it. The primer was annealed to the template and then extended using a DNA polymerase, ligated using DNA ligase to seal the nick and the mismatched duplex transformed into bacteria. PCR mutanenesis: Because single-stranded template method is not very efficient and because subcloning in M13 to prepare single-stranded DNA is time consuming, much site-directed mutagenesis is now carried out using the polymerase chain reaction (PCR), Yang Xu, College of Life Sciences

J 6 Applications of cloning • Applications • Recombinant protein • Genetically modified organisms • DNA fingerprinting • Medical diagnosis • Gene therapy Yang Xu, College of Life Sciences

Applications Importance of gene cloning: The gene cloning has made a great impact on the speed of biological research and it is increasing its presence in several areas of everyday life. Applications: These include: • recombinant protein production; • genetically modified organisms; • DNA fingerprinting; • diagnostic kits • gene therapy This topic describes some of these applications. Yang Xu, College of Life Sciences

Recombinant proteinproduction Purpose: Some proteins that are known to be missing or defective in various disorders. These include growth hormone, insulin, interferon, blood clotting factor VIII and so on. Production of protein from a cloned gene can solve these problems. Main methods: • In bacteria:  Initially, production in bacteria was the only way available. cDNAs had to be linked to prokaryotic transcription and translation signals and inserted into multi-copy plasmids.  However, often the overproduced proteins were lacked eukaryotic post-translational modifications. • In eukaryotic cells:  Production in yeast or mammalian cell lines has helped greatly.  For example, the human factor VIII protein, which is administered to hemophiliacs (血友病), is produced in a hamstercell line which has been transfected with a 186 kb human genomic DNA fragment. Yang Xu, College of Life Sciences

Genetically modified organisms Definition: Genetically modified organisms (GMO) are created when cloned genes are introduced into germ cells. In eukaryotes, if the introduced genes are from another organism, the transgenic plants or animals can be propagated by normal breeding. • Examples: • Transgenic plants: One example is a tomato that has had a gene of a ripening enzyme inactivated. The strain of tomato takes longer to soften. • Transgenic sheep: They produce valuable proteins in their milk. The desired gene requires a sheep promoter to be attached to ensure expression in the mammary gland. Yang Xu, College of Life Sciences

DNA fingerprinting Definition: The Southern blots of genomic DNA with probes that recognize simple nucleotide repeats gives a pattern that is unique to an individual and can be used as a fingerprint. Applications: For example • Maternity and paternity testing in humans; • To show pedigree in animals bred commercially. Analysis: • Some of these bands will be in common with those of the mother and some with those of the father. The different patterns in individuals at each of these kinds of simple repeat. Yang Xu, College of Life Sciences

Medical diagnosis Background: A great variety of diseases arise from mutation. In genetic disorders, individuals are born with faulty genes that cause the symptoms of the disorder. Many cancers arise due to spontaneous mutations in somatic cells in genes whose normal role is the regulation of cell growth. Diagnostic kits: By using sequence information to design PCR primers and probes, many diagnostic kits have been developed to screen patients for these clinically important mutations. Yang Xu, College of Life Sciences

P53 gene therapy Gene therapy Definition: Attempts have been made to treat some genetic disorders by delivering a normal copy of the defective gene to patients. This is known as gene therapy. Examples of the methods: • Defective virus: The gene can be cloned into a defective virus used as a vector that can replicate but not cause infection. • Bone marrow transplant: For treating some disorders, the bone marrow must be destroyed and is replaced with treated cells that have had a normal gene, or a protective gene, introduced. Perspective: Gene therapy is in its infancy, but it seems to have great potential. Yang Xu, College of Life Sciences

That’s all for Section J Yang Xu, College of Life Sciences

J 1 Characterization of clones