1 / 19

Role of Oxytocin in Spermatogenesis and Steroidogenesis in Mice: Towards Development of Precocious Puberty

This study investigates the potential role of oxytocin in regulating spermatogenesis and steroidogenesis in mice. The study explores the molecular mechanisms by which oxytocin affects testicular function and hormone production.

nobuko
Download Presentation

Role of Oxytocin in Spermatogenesis and Steroidogenesis in Mice: Towards Development of Precocious Puberty

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. A possible role of Oxytocin on spermatogenesis and steroidogenesis in mouse: An approach towards development of precocious puberty Speaker: Dr. Shabana Anjum (Ph.D.) Department of Zoology, Banaras Hindu University Varanasi 221005, India

  2. General concept of Hypothalamic–Pituitary-Testicular axis GnRH H • GnRH is primary regulator of gonadotropins (LH and FSH) secretion • A hypothalamic decapeptide factor, known as Gonadotropin Releasing Hormone (GnRH) was discovered in brain of mammals • OXT-receptor are present on GnRH neuron and Oxytocin modulate the GnRH release from the hypothalamus (Caligioni et al., 2007) Anterior Pituitary P Posterior Pituitary Gonadotropins FSH LH Oxytocin Feed back loop Testosteroneee Estradiol Spermatogenesis Steroid Production T

  3. OXYTOCIN • Oxytocin is a neuro-peptide, produced by the Paraventricular nucleus (PVN) of the hypothalamus and released from the posterior pituitary • It is nanopeptide with disulphide bridge • Traditionally known as female hormone, where it regulate uterine contraction, milk ejection and parturition • In male, OXT modulate sexual behavior, ejaculation and seminiferous tubule contraction that help in transfer of sperm to epididymis

  4. Hypothalamic OXT Cys-Tyr-Ile-Gln-Asn-Cys-Pro-Lec-Gly-NH2 Extra Hypothalamic OXT Ovaries ? ? ? ? Testes Testis Molecular mechanism by which OXT affect testicular steroidogenesis is not yet known

  5. Is there any role of OXT in Spermatogenesis and Steroidogenesis?? How it is regulating Steroidogenesis??

  6. Objective of my study Regulation of OXT through Luteininzing hormone Role of OXT on steroidogenesis and spermatogenesis

  7. Testes was cultured for 24 hour in culture medium (DMEM + Ham’s F-12 Culture medium Testis Experimental design Syntocinon/OXT (N=8 per groups) In vitro (N=3 per groups) In vivo Testis Serum Steroidogenic factors ELISA for Testosterone ELISA for Testosterone Group (1): Control Group (2): 0.25 IU/BW (Low) OXT Group (3): 1.0 IU/BW (High) OXT For 8 days I.P. On 28th day of postpartum Group A: (1) Control; (2) 0.05 IU/mL OXT; (3) 10 ng/mL LH (4) 10 ng LH+0.05 IU OXT Steroidogenic factors Spermatogenic Factors

  8. Effect of OXT on testosterone level in serum and 3β HSD enzyme activity in testis c b (A) a Testosterone level (ng/mL) Dose of OT (IU/day/BW) Dose of OT (IU/day/BW) 1.0 1.0 0.25 0.25 c (B) 3 β HSD Enzyme Activity (n mol NADH/hr/mg of protein) b a - - + + + + Figure 1

  9. Effect of OXT on histological study in testis (in vivo) (B) (A) (C) rSt rSt rSt p Sc p Sc pl S SC pl Sc SC p Sc pl Sc B Sg LC LC LC 1.0 IU (OT) 0.25 IU (OT) Control (OT) Figure 2

  10. Effect of OXT on Oxytocin receptor mRNA in testis (in vivo) Control 0.25 IU 1.0 IU 1000 900 800 700 600 500 400 300 200 100 c 350 bp b mRNA levels a Dose of OT (IU/day/BW) 1.0 0.25 Oxytocin receptor Forward F(1C) 5'GGACGTCAATGCGCCCAAAGAAG3' Reverse (R8) 5'ACTCGAGCTGCAACGACTCA3' - + + Figure 3

  11. Effect of OXT on LH-R and StAR Protein expression in testis (in vivo) (B) (A) LH-R StAR β- actin β- actin Dose of OT (IU/day/BW) Dose of OT (IU/day/BW) 1.0 1.0 0.25 0.25 c c b % RIDV % RIDV a b a - - + + + + Figure 4

  12. Effect of OXT on PCNA protein expression in testis (in vivo) (A) (C) (B) p Sc pl Sc p Sc B Sg pl Sc Dose of OT (IU/day/BW) L L 1.0 B Sg 0.25 Control 0.25 IU 1.0 IU c b (D) PCNA % RIDV a β-actin - + + Figure 5

  13. Effect of OXT on Bcl2 and Androgen receptor protein expression in testis (in vivo) c b % RIDV a (A) Bcl2 β Actin Dose of OT (IU/day/BW) Dose of OT (IU/day/BW) 1.0 1.0 0.25 0.25 c (B) AR % RIDV b β-actin a - - + + + + Figure 6

  14. Effect of OXT on GnRH-R protein expression in testis (in vivo) c b a GnRH-R % RIDV Dose of OT (IU/day/BW) 1.0 0.25 β Actin - + + Figure 7

  15. Effect of OXT on testosterone level in media and StAR protein expression in testis (in vitro) d c (A) StAR b Testosteronelevel (ng/mL) a (B) 0.05 0.05 - - Dose of OT (IU/mL) Dose of OT (IU/mL) - - - Dose of LH (ng/mL) Dose of LH (ng/mL) 10 10 β-actin d c % RIDV b a - - 0.05 0.05 10 10 - Figure 8

  16. Effect of OXT on GnRH-R protein expression in testis (in vitro) c 0.05 - Dose of OT (IU/mL) - % RIDV Dose of LH (ng/mL) 10 d a b GnRH-R β-actin - 0.05 Figure 9 10 -

  17. Conclusion… • OXT treatment causes significant changes in the spermatogenic and steroidogenic • activity in testis of pre-pubertal mice • OXT showed increaased proliferation of germ cell by increased expression of PCNA, • AR and Bcl2 protein in testis • OXT stimulate testosterone synthesis due to stimulatory effect on 3 β HSD activity and • increased expression of StAR and LH-R protein in testis • OXT stimulate the GnRH-R protein expression in testis • Thus, OXT may act as autocrine/paracrine factor for the testicular activity and locally produced OXT may act throgh autocrine/paracrine mechanism by Leydig cell

  18. Summary of the study.. Syntocinon/OXT In vitro study In vivo study Pre-pubertal Age ST Leydig cell Histopathologicalchanges LH-R StAR 3βHSD • Germ cells in stage VII seminiferous tubules • Expression of PCNA protein in spermatogonia • Expression of AR expression Detection of anti apoptotic germ cells GnRH-R Testosterone Expression of Bcl2 As a autocrine/paracrine factor and enhanced reproductive activity /Precocious puberty

  19. Thank you

More Related