1 / 46

Predicting Lentiviral Vector Safety In Vivo

Predicting Lentiviral Vector Safety In Vivo. Principal issues: Recombination and RCL. In vitro QA/QC. Status of field. Tremendous advances in vector safety design while retaining efficient gene transfer in vivo. . Challenges for for clinical testing.

norton
Download Presentation

Predicting Lentiviral Vector Safety In Vivo

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Predicting Lentiviral Vector Safety In Vivo

  2. Principal issues: Recombination and RCL In vitro QA/QC Status of field • Tremendous advances in vector safety design while • retaining efficient gene transfer in vivo. Challenges for for clinical testing • Devise an approach(s) for safe administration of vector

  3. y LTR Prom. gene LTR Gag RRE CMV pA Pol CMV VSV-G pA • Neither 2nd nor 3rd generation vectors produce RCL in vitro • gag/gag-pol-vector (env-minus) recombinants can be produced • in primary transduced cells Emergence of RCL is the Principal Safety Concern (transduction/primary recombination) ? env- LTR-gag-pol-env-LTR LTR-gag-pol-LTR

  4. Safety Considerations Genetic recombination • likely • - experience with retrovirus vectors • - utilized for reverse transcription • underpins generation of RCL/safety

  5. in vitro RCL in vivo RCL X Safety Considerations Generation of RCL in vivo • in vitro = generation of LTR-gag-pol-env-LTR- • like recombinants • in vivo = failure in vector safety and/or QC

  6. What Requisite Biosafety Measures • QA/QC testing (LV stocks) a. PCR assay b. RCL assay c. Gag-Pol recombinant assay

  7. RCL assay Advantages: • Detects replication competent recombinants Disadvantages: • Not predictive against the emergence of RCL in vivo • Not informative of non-RCL recombinants ? Genetic composition of recombinants ? Functionality or replication potential of recombinants ? How the host will interact with the recombinants ? How recombinants will interact with host ? Risk to the treated individual

  8. PCR assay Advantages: • Detects vector- and/or packaging-specific DNA Disadvantages: • Biologically non-specific • Specificity

  9. Gag-Pol Recombinant Assay Advantages: • Enables monitoring of vector stocks for pre-RCR • recombinants - Specifically, recombinants with a • functional gag-pol coding region Significance:

  10. Gag-Pol Recombinant Assay Significance • Shows gag-pol-vector recombinants are produced • Without functional gag-pol (LTR-gag-pol-LTR), RCL • cannot be generated in primary transduced cells • Functional gag-pol is required for the recombinant to • generate RCL in vivo • Thus, in vitro monitoring for functional gag-pol-containing • recombinants provides a tangible way to analyze LV stocks • in vitro for their potential to generate RCL in vivo

  11. y LTR Prom. gene LTR Gag RRE CMV pA Pol CMV VSV-G pA Hypothesis Recombination QC surrogate (gag-pol recombinants) Recombination in vivo? RCL?

  12. Analysis of Genetic Recombination • Genetic Recombination Underpins the generation of RCL • Approach: • Detect • Enrich • Characterize • - genetically • - biologically

  13. y LTR Ga puro LTR RRE Approach for Analyzing Genetic Recombination HeLa-puro

  14. T a t Approach for Analyzing Genetic Recombination HeLa-puro Recombinant y LTR ga tat LTR y LTR ga RRE puro LTR puromycin Selection and characterization of recombinant-containing cells

  15. pol RRE pA CMV gag DU3 y ga RRE CMV R U5 trans-gene RSV R U5 rev pro SD pA RRE CMV gag pA RT IN vpr RRE LTR State-of-the-Art Vector Components 3rd generation packaging construct SIN vector Trans-lenti vector +

  16. RT IN Pro Split Function Lentiviral Vector System Packaging Construct tat rev rev SD RRE poly A CMV gag tat Vector Construct y LTR Ga RRE CMV GFP LTR Env Construct CMV VSV-G poly A

  17. LTR LTR gag pol RRE Mock Lentiviral Vector - Nevirapine + Nevirapine 0 CFU 1000 CFU 0 CFU Lentiviral Vector tat Transfer HeLa-Puro tat 107 IU LTR-puro Puromycin Selection • Generation of tat-containing recombinants

  18. LTR LTR LTR LTR gag gag pol pol RRE RRE Lentiviral Vector gag Transfer HeLa-Puro 107 IU gag-pol orf ? LTR-puro Infection Puromycin Selection pVSV-G ptat/rev Mock Lentiviral Vector - Nevirapine + Nevirapine 0 CFU 540 CFU 0 CFU • Generation of recombinants with functional gag-pol genetic structure

  19. . . 2054 bp PCR U3 R U5 gag EXPAND Genetic Analysis of Recombinant Proviral DNA

  20. 5’ Sequence Analysis of Genetic Recombinants orf (100%) R U5 gag

  21. Recombination within the Poly(A) Tract of the Packaging Construct Packaging construct (47) (53) (63) mRNA … AAUGAAA… AAAAAAAAAAAAAAAAAAAAAA... (pA signal) u3 r u5 cDNA RNA template AAAA U3 R n Vector

  22. (AAA) 47 (AAA) 53 (AAA) (AAA) 45 63 3’ Sequence Analysis of Genetic Recombinants Packaging Construct (3’ end) Vector (3’ LTR) pA signal tat/rev U3 R U5 RRE 108 32 U3 PPT (x 6) AAGAGGAGGAGGAGGTGGG...GGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGA (x 1) AAGAGGAGGAGGAGGTGGG...GGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGA (x 1) AAGAGGAGGAGGAGGTGGG...GGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGA (x 1) ATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGA

  23. tat rev pro rev pA CMV RRE gag tat RRE Trans-Lentiviral Vector System Packaging construct Trans-enzyme construct vpr pA RT IN LTR

  24. LTR LTR gag pro RRE 0 # colonies TLV Impairs Gag Transfer/DNA mobilization 107 IU HeLa-Puro LTR-puro ? Infection Puromycin selection pVSV-G ptat/rev • Trans-lenti vector does not generate detectable recombinants • Block in DNA mobilization due to trans-RT-IN • Absence of functional Gag-Pol (RT-IN) blocks mobilization

  25. Summary: Analysis of lentiviral vector recombination • Recombination occurs between the lentiviral packaging construct and • gene transfer vector • Integrated recombinants express viral proteins including, Tat, Gag, • and the entire Gag-Pol precursor polyprotein • The expression of the integrated gag and pol gene produces progeny • env-deficient recombinant lentivirus particles • These particles package mRNA and if pseudotyped, mobilize the mRNA • to other target cells where it is reverse transcribed and integrated

  26. Summary: Analysis of lentiviral vector recombination • Recombination within the mRNA poly(A) tract: • confirmed genetic recombination during reverse transcription • in the infected cell • suggested that removing homologous sequences from the vector and • packaging construct may not be sufficient to prevent recombination • may represent a mechanism by which genes without homologous • sequence can be mobilized, including endogenous genes (Huang et al., • Cell: 44:936, 1986; Raines et al., J. Virol. 62:2437, 1988)

  27. DU3 y ga RRE CMV R U5 trans-gene RSV R U5 tat rev pro rev pA CMV RRE gag tat Tat-Independent Analysis of Genetic Recombination 3rd generation packaging construct PR RT IN RRE pA CMV gag SIN vector Trans-lenti + vpr RT IN pA RRE LTR

  28. y DU3 DU3 gag pol y LTR LTR puro puro LTR LTR Gag-Pol-Dependent DNA Mobilization Assay 108 - 3rd gen. 108 - 3rd gen/SIN 109 - trans-lenti HeLa-tat CMV-tat Recombinant y Infection pVSV-G Puromycin selection ptat/rev

  29. 3rd gen., vector 3rd gen., Env Gag-Pol Dependent DNA Mobilization 3rd gen. SIN + 3rd gen. trans-lenti

  30. Conclusions • The 3rd generation packaging construct and SIN vector generate • recombinants with functional gag-pol capable of mobilizing DNA • Separating RT and IN from the packaging construct decreases the • frequency of regeneration of a functional gag-pol structure (and DNA • mobilization) by at least 2 orders of magnitude • Since a functional gag-pol genetic structure is absolutely required for • the generation of RCL, monitoring vector stocks for the production • of env-minus gag-pol-containing recombinants may serve as an in • vitro surrogate marker to control against generating RCL in vivo. • The trans-lentiviral vector design is particularly amenable for • functional gag-pol QC testing

  31. Utility of in vitro monitoring for functional gag-pol-containing recombinants to QC against the potential of vector stocks to produce RCL in vivo Theoretical ? Biologically significant ?

  32. Gp120-Receptor-Independent Mechanism(s) for HIV-1 Infection • Cellular membrane proteins are incorporated into virion during • budding (Arthur et al., Science 258:1935, 1992) • The initial binding of HIV to target cells does not require Env- • receptor interaction (Mandor et al., J. Virol. 72:3623, 1998; • Wu et al., submitted) • Interaction between cell-derived membrane protein and receptor • on cell surface facilitates initial binding (Wu et al., submitted) • Interaction between cell-derived membrane protein and a cellular • receptor can support HIV-1 infection (Enders et al., Science 278:1462, • 1997; Mebatsion et al., cell 90:841, 1997; Schnell et al., Cell 90:849, 1997) • HIV Env-independent infection of CD4-minus epithelial cells • (Duan et al., J. Virol. 74:10994, 2001)

  33. y y LTR LTR LTR LTR gag-pol gag-pol Perpetuate Risk for RCL Env-minus virions Infection • Each cycle of replication represents an additional opportunity • for genetic recombination and the generation of RCL

  34. Analysis of Env-Minus Vector Infectivity Env-minus vector CD4-minus 1. Virion binding 3. Entry route 4. Infection/proviral formation 2. cDNA synthesis

  35. Attachment Independent of CD4 & gp120 HeLa CD4+ HeLa CD4- Env+ Env-

  36. Vector DNA Synthesis Independent of gp120-CD4 Receptor-Mediated Entry 293 HeLa JC53 - - - - - - + + + 3TC: - - - + + + + + + Infection: R-U5 R-gag

  37. Env+ Env- - + - + BFLA1: R-U5 Vector DNA Synthesis in Acidified Endosomes

  38. Analysis of Vector Infectivity in CD4-minus Cells HT-1080 Tu139 Vector particles HeLa JC53 BFLA1+ BFLA1— BFLA1+ BFLA1— DEnv 4.8x102 7.3x103 3.3x103 2.8x103 0 0 Env 2.5x103 1.8x104 5.0x103 3.5x103 ND 1.5x105 VSV-G 7.7x104 2.4x106 ND ND ND ND

  39. Nature Medicine 6:652, 2000 Science 283:682, 1999 Nature 406:82, 2000 Stem Cells 18:352, 2000 Science 290:767, 2000 J. Neurosci. 20:5587, 2000 Promise of Lentiviral Vectors for Gene Therapy Hematopoietic Stem Cells Central Nervous System Disorders Eye Diseases Proc. Natl. Acad. Sci. 94:10319, 1997

  40. GFP Expression in Blood Cells 16 Weeks After Stem Cells Transplantation Mononuclear Cells Neutrophils & Monocytes Vector B Cells T Cells 10.1% 6.5% 8.2% 13.9% Trans-lenti Lentiviral 9.6% 9.0% 8.0% 11.9% Numbers represent the percentage of cells that were GFP +

  41. Transduction of Neurons In Vivo

  42. Transduction of Retinal Pigment Epithelium (Histologic Assessment)

  43. Conclusions • The formation of proviral DNA recombinants with a functional • gag-pol coding region may increase the risk for RCL • In vitro monitoring for functional gag-pol-containing recombinants • may serve as a surrogate marker to control against the emergence • of RCL in vivo • The trans-lentiviral vector design splits the gag-pol function and • therefore, is particularly well suited for gag-pol QC monitoring

  44. y Gag RRE CMV pA LTR prom. gene LTR Pro CMV VSV-G pA Recombination (LTR-gag-pro-LTR) In vitro Monitoring to Predict the Potential for Generating RCL in vivo QC surrogate (gag-pol recombinants) Recombination in vivo? RCL?

  45. Acknowledgments UAB U. Penn. Tranzyme Inc. Jean Bennett John Wakefield Lilin Lai Hongmei Liu Yimin Wang Xiaoyun Wu Tim Townes WenYong Chen Lori McMahon

  46. Safety Considerations • Insertional mutagenesis • Unknown pathogenicity or pathogenic potential of • recombinant lentiviral vectors (including human and • non-human) • * The ability of lentiviral vectors to infect non-dividing • cells raises safety issues for which we can not drawl • upon prior experience with retroviral vectors • Genetic recombination • Generation of RCL in vivo • Quality assurance & quality control (QA/QC)

More Related