Mitochondrial DNA variability in four Italian donkey breeds (Equus asinus)

1. Nuove acquisizioni in materia di Ippologia New findings in equine practice Druento, 31 ottobre 2008 Mitochondrial DNA variability in four Italian donkey breeds (Equus asinus) • M.C. Cozzi1, P. Valiati1, R. Cherchi2, M.G. Strillacci1, • Corona2, G. Pertica1, B. Gandolfi1, M. Polli1, M. Longeri1, • L. Guidobono Cavalchini1 1DSA - Dipartimento di Scienze Animali – Sezione di Zootecnica Veterinaria – Milano 2 ERA - Ente di Ricerca in Agricoltura Sardegna - Ozieri

2. Introduction Italian donkey breeds had suffered a substantial decrease in population size due to mechanization of agriculture during the last Century. Most donkey populations have declined to levels considered as endangered by FAO with a high risk of extinction in a short time period. For a long time this animal was essentially ignored under a research point of view but the interest of researchers was recently renewed for several reasons. Furthermore, the interest in donkeys productions is increased. Particularly, in the use of donkey's milk for human nutrition as a valid alternative to cow's milk in case of allergy and to the pet therapy, or “onotherapy”. Efforts to increase the existing donkey population are being carried out as a consequence of the development of these productions.

3. Introduction The aim of this work was to study mitochondrial DNA genetic variability in 4 Italian donkey breeds.

4. Material and methods Blood samples from 91 donkeys were collected. 6 Romagnolo donkey (ROD) 28 Asinara donkey (ASD) 6 Ragusano donkey (RAD) 49 Sardo donkey (SAD)

5. Material and methods The mitochondrial DNA (mtDNA) of donkey was extracted using standard procedure. Specific primers were used to amplify a 478 bp fragment of the mtDNA between sites 15385 to 15862 according to the donkey reference sequence GeneBank #X97337. >X97337 CCCCAAGGACTATCAAGGAAGAAGCTCTAGCTCCACCATCAACACCCAAAGCTGAAATTCTACTTAAACTATTCCTTGATTTCCTCCCCTAAACGACAGCAATTCATCCTCATGTGCTATGTCAGTATTAAAATACACCCCCGCACAACACCATATCAGCTCAACATACAATACTCTATTAATACCCTATGTACATCGTGCATTAAATTGTTCACCCCATGAATAATAAGCATGTACATAATATTATTTATCTTACATGAGTACATCATATTATTGATCGTACATACCCCATCCAAGTCAAATCATTTCCAGCCAACACGCATATCACCACCCATATTCCACGAGCTTAATCACCAAGCCGCGGGAAATCAGCAATCCCTCCAATTACGTGTCCCAATCCTCGCTCCGGGCCCATCTAAACTGTGGGGGTTTCTACGGTGAAACTATACCTGGCATCTGGTTCTTTCTTCAGGGCCATT

6. Material and methods PCR products were purified and sequenced using Big Dye Terminator (Applied Biosystems). Sequences were determined by ABI PRISM® 310 Genetic Analyser and were analyzed using specific software.

7. Material and methods Statistical analyses • CLUSTALX version 1.8 • DnaSPversion 4.2 • Haplotype diversity (hd), nucleotide diversity (), average number of nucleotide differences (k) and Fu’s Fs statistic. • NETWORK version 4.5.0.1 • Median-Joining Network and mismatch analysis. • MEGA version 4.0 • Genetic distances by the Kimura-two parameter method and haplotypes phylogenetic tree by Neighbor-Joining algorithm.

8. Results and discussion 10 haplotypes were identified in the analyzed populations, ranged from 4 (RAD and ASD) and 6 (SAD). 20 polymorphic sites were detected, 19 of them were phylogenetically informative and one was singleton (Tab. 1). Table 1 – Sample size (N), number of haplotypes (n), polymorphic sites, parsimony informative and non informative sites.

9. Results and discussion All the haplotypes were shared among breeds, but haplotype H1 (ROD), H7 and H10 (SAD) (Tab. 3). Table 3 – Position of substitution sites and haplotypes identified on the 4 Italian breeds.

10. Results and discussion The nucleotide diversity (π) value representing the breed genetic diversity and ranged from 0,0046 (RAD) e 0,0204 (ROD), average value 0,0174. The haplotype diversity (hd) value ranged from 0,638 ASD and 0,867 ROD, average value 0,822, and the average number of nucleotide differences k=8,315. All the molecular indices indicate a sufficient variability between breed (Tab. 2). Table 2 – Molecular diversity indices with standard deviations (s.d.) for breeds and across the four breeds.

11. Results and discussion Figure 2 – Mismatch distribution of the 91 mtDNA donkey sequences. Relative frequency The mismatch analysis and Fu’s Fs statistic were used to investigate the demographic expansion of donkey populations. Figure 2 showed a bimodal distribution. Pairwise differences ranged from 0 to 18. A major pick was present at 1 mutational difference and a secondary one at 17 differences. The value for Fu’s Fs statistic was 8,441 probability 0,001. As reported in other species, the bimodal distribution separate by a large time interval obtained, it could represent a two times temporal expansion of Italian donkey populations, out of a common ancestral population. Pairwisedifferences

12. Results and discussion A In figure 3 the Median-Joining Network on 91 donkey mtDNA sequences was shown. Two haplogroups A and B separated from 12 nucleotide substitutions were found. The two haplogroups include haplotypes that differ from each other by few mutations: 1 to 5 mutations haplogroup A, 1 to 3 mutation haplogroup B. B H06 H05 H07 H03 H03 H08 H09 H10 H01 H04 SAD ASD RAD ROD X97337 Figure 3 - Median joining network of 10 mtDNA haplotypes identified on 4 donkey breeds. The area of the circle is proportional to sample frequency.

13. Results and discussion In figure 4 the phylogenetic tree constructed using genetic distances between mtDNA sequences of Italian donkey breeds was depicted. Two different clusters/haplogroups were defined. These haplogroups comprise haplotypes where common origins are assumed since they share characteristic mutations to slow evolution. Figure 4 – Neighbor-Joining tree constructed on the bases of Kimura two parameter distances by donkey mtDNA haplotypes

14. Figure 5 – Neighbor-Joining tree constructed on the bases of Kimura two parameter distances by Italian donkey mtDNA haplotypes, domestic donkey mtDNA haplotypes, African and Asian Wild Donkeys.

15. Conclusion In conclusion, our study on mtDNA of four Italian donkey breeds have been evidenced: • genetic variability was found in the analyzed breeds; • 3 typical haplotypes were identified: 2 in Sardinian donkey and 1 in Romagnolo donkey; • two different haplogroups A and B clustered (ancestral haplotype diversification ); • in a worldwide contest, two main clusters were found: one referred to haplogroup B clustered with Equusasinusasinus sequences and a second one, referred to haplogroup A closely related to Equusasinussomaliensis.