BIOTECHNOLOGY

1. How can we use DNA to help humans? BIOTECHNOLOGY

2. Is eating genetically modified (GM) food bad for you?  This is a controversial subject!  Genetically modified foods are everywhere. You almost definitely eat them without even knowing! Do you think that’s ok?  Some of the most common genetically modified foods include corn, rice,potatoes, tomatoes, peas and dairy products!  These foods are produced using the process of Genetic Engineering – genes that code for desired proteins are put into the plants.  HOWEVER, sometimes genes that were not desired are on the same segment of DNA. This is where the “danger” MAY arise.

3. DNA Fingerprinting • Each individual (except clones and identical twins) has a unique DNA sequence. • This sequence can be used to produce a DNA fingerprint, a unique band pattern of DNA fragments.

4. Fill It In … Compare a DNA fingerprint with a typical fingerprint:

5. DNA Fingerprinting • A DNA fingerprint is produced using a gel electrophoresis. • A gel electrophoresis is a machine that separates pieces of DNA based on size (the number of base pairs)

6. DNA Fingerprinting • The process of producing a DNA fingerprint can be described in three basic steps: 1. A restriction enzymeis used to cut the DNA sample into pieces. A restriction enzyme binds to a specific sequence of DNA bases, called a restriction site, and cuts (cleaves) the DNA between two of the bases in that site. This produces many pieces of different sizes.

7. DNA Fingerprinting • The process of producing a DNA fingerprint can be described in three basic steps: 2. Once the restriction enzymes have recognized all the restriction sites and have cleaved the DNA into pieces, the sample is loaded into a gel for electrophoresis.

8. DNA Fingerprinting • The process of producing a DNA fingerprint can be described in three basic steps: Electricity forces the DNA pieces to move through the gel. Smaller pieces are able to move farther than larger pieces. The electrophoresis creates a separation of pieces by size - making a column of bands.

9. Gel electrophoresis • A method of separating DNA in a gelatin-like material using an electrical field • DNA is negatively charged • when it’s in an electrical field it moves toward the positive side DNA        – + “swimming through Jello”

10. DNA Fingerprinting • The process of producing a DNA fingerprint can be described in three basic steps: 3. The DNA sequence of different individuals will have different numbers of restriction sites, or restriction sites in slightly different places. The variation of restriction sites means that an individual’s band pattern will likely be different from other individuals.

11. DNA fingerprint • Why is each person’s DNA pattern different? • sections of “junk” DNA • doesn’t code for proteins • made up of repeated patterns • CAT, GCC, and others • each person may have different number of repeats • many sites on our 23 chromosomes with different repeat patterns GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA GCTTGTAACGGCATCATCATCATCATCATCCGGCCTACGCTT CGAACATTGCCGTAGTAGTAGTAGTAGTAGGCCGGATGCGAA

12. DNA Fingerprinting • The process of producing a DNA fingerprint can be described in three basic steps: 3. By comparing band patterns, we can determine many things.

13. Uses: Forensics • Comparing DNA sample from crime scene with suspects & victim suspects crime scene sample S1 S2 S3 V – DNA  +

14. Fill It In … Find ONE WORD that describes each of the three steps of making a DNA fingerprint. A hint is given! Write the word below: • C_______ • E_______ • C_______

15. DNA fingerprints can be used for several applications • A DNA Fingerprint can be used for several reasons. A DNA fingerprint can be used to identify an individual, or determine the source of DNA left at a crime scene. • Example: a bloody knife was found a short distance from a murder victim. Two suspects have been identified” Blood on Knife Victim Suspect A Suspect B ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____

16. DNA fingerprints can be used for several applications • Explanation: the blood on the knife came from two sources - the victim and another person (we can eliminate the bands of the victim, but other bands remain). By comparing the remaining bands, it is clear that Suspect A is cleared, and Suspect B is …. suspect Blood on Knife Victim Suspect A Suspect B ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____

17. Fill It In … Highlight the shortest piece of DNA in this fingerprint. Blood on Knife Victim Suspect A Suspect B ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ ____ What tool/process was used to create this fingerprint?

18. Electrophoresis use in forensics • Evidence from murder trial • Do you think suspect is guilty? blood sample 1 from crime scene blood sample 2 from crime scene blood sample 3 from crime scene “standard” blood sample from suspect OJ Simpson blood sample from victim 1 N Brown blood sample from victim 2 R Goldman “standard”

19. DNA fingerprints can be used for several applications • A DNA Fingerprint can be used to determine thepaternity of a child.

20. Mom F1 F2 child Uses: Paternity • Who’s the father? – DNA  +

21. DNA fingerprints can be used for several applications • Example: a millionaire has been charged with several paternity cases. His lawyer ordered DNA Fingerprints: Richy Rich Mother A Child A Mother B Child B Mother C Child C _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ ____ _____ _____ _____ _____ _____ _____

22. DNA fingerprints can be used for several applications • Explanation: because half of your DNA is inherited from your mother and half from your father, each band in a child’s patter will also appear in either the pattern of the mother or of the father. Richy Rich Mother A Child A Mother B Child B Mother C Child C _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____

23. DNA fingerprints can be used for several applications • Explanation: Child A could NOT be Richy Rich’s child because of the third band in the child’s pattern. Child C could NOT be Richy Rich’s child based on the third band in the child’s pattern. Child B COULD be Richy Rich’s child. Richy Rich Mother A Child A Mother B Child B Mother C Child C _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____ _____

24. Fill It In … How is analyzing a DNA fingerprint for paternity DIFFERENT than analyzing a fingerprint to identify an individual’s DNA from a crime scene?

25. 1 2 3 4 5 1 2 3 4 5 Uses: Evolutionary relationships • Comparing DNA samples from different organisms to measure evolutionary relationships turtle snake rat squirrel fruitfly – DNA  +

26. DNA fingerprints can be used for several applications • DNA fingerprinting can be used to catalog endangered species. • For example, researchers have developed DNA banks of endangered species protected by law. • This allows them to prove if endangered species are used in products, such as medicines or food.

27. DNA Finger Printing • A few examples of how DNA fingerprinting can be used • 2004 tsunami in Southeast Asia • African-American history • 9/11

28. Who Stole the Lollypop? • Who Stole the Lollypop? • A Link for the Missing

29. Check Yourself! • What is a DNA Fingerprint? • What technology is used to make a DNA Fingerprint? • What type of enzymes are used to cut DNA? • What are three uses for DNA fingerprinting?

30. Check Yourself! • What is a DNA Fingerprint? A UNIQUE BAND OF DNA FRAGMENTS • What technology is used to make a DNA Fingerprint? • What type of enzymes are used to cut DNA? • What are three uses for DNA fingerprinting?

31. Check Yourself! • What is a DNA Fingerprint? A UNIQUE BAND OF DNA FRAGMENTS • What technology is used to make a DNA Fingerprint? GEL ELECTROPHORESIS • What type of enzymes are used to cut DNA? • What are three uses for DNA fingerprinting?

32. Check Yourself! • What is a DNA Fingerprint? A UNIQUE BAND OF DNA FRAGMENTS • What technology is used to make a DNA Fingerprint? GEL ELECTROPHORESIS • What type of enzymes are used to cut DNA? RESTRICTION ENZYMES • What are three uses for DNA fingerprinting?

33. Check Yourself! • What is a DNA Fingerprint? A UNIQUE BAND OF DNA FRAGMENTS • What technology is used to make a DNA Fingerprint? GEL ELECTROPHORESIS • What type of enzymes are used to cut DNA? RESTRICTION ENZYMES • What are three uses for DNA fingerprinting? CRIME SCENE INVESTIGATION DETERMINING PATERNITY CATALOG ENDANGERED SPECIES

34. Genetic Engineering • Genetic engineering is the modification of DNA. • Modification means changing, such as adding or removing parts of the DNA sequence.

35. Genetic Engineering • Genetic engineering may be used to produce a transgenicorganism (an organism which contains foreign DNA) to use in gene therapy or gene cloning.

36. Fill It In … WORD HELP! “trans” means to __________ “genic” means ___________

37. Genetic engineering can be used for several applications • Genetic engineering can be used to create a transgenic organism

38. Genetic engineering can be used for several applications • Restriction enzymes are used to cleave the foreign DNA source in order to isolate the desired gene. • For example, removing the insulin gene from human DNA

39. Genetic engineering can be used for several applications • The same restriction enzyme is used to cleave the vector (which may be a bacterial plasmid). • A vector is the structure used to carry the foreign DNA.

40. Genetic engineering can be used for several applications • The foreign DNA fragment (the desired gene) and the vector are combined/spliced together.

41. Genetic engineering can be used for several applications • The combination is possible for two reasons. • First, DNA is similar in all organisms. • Second, the same restriction enzyme is used on both samples of DNA

42. Genetic engineering can be used for several applications • The combined DNA (called recombinant DNA) is inserted into the host (which may be a bacteria cell) • The host cell will copy/clone the recombinant DNA as it reproduces and will produce the protein (such as insulin) from the desired gene during protein synthesis.

43. Genetic engineering can be used for several applications

44. Fill It In … How are each of the words related to genetic engineering? • Vector - • Recombinant DNA - • Host cell -

45. Fill It In … Find ONE WORD that completes the short description of each of the four steps. A hint is given! Write the word below: • C_________ DNA • V_________ opened • C_________ together • I__________ into host

46. Weird Science! • 5 percent of U.S. corn and 85 percent of U.S. soybeans are genetically engineered, and it’s estimated that 70 to 75 percent of processed foods on grocery store

47. Glow in the dark cats

48. Enviropig • Digest and process phosphorus

49. Pollution- fighting plants • Absorb and clean soil through their roots

50. Venomous Cabbage • Scorpion Venom to kill caterpillars but not harmful to humans