Mutation

1. Mutation Xuhua Xia xxia@uottawa.ca http://dambe.bio.uottawa.ca

2. Mutation • - any detectable change in DNA sequence • eg. errors in DNA replication/repair • inherited ones of interest in evolutionary studies Deleterious - will be selected against and lost (purifying selection) Advantageous • will be fixed in population by natural selection • - rare occurrence Neutral • will have not effect on phenotype • - may be fixed in population by genetic drift

3. Type of Mutations 1. Point mutations = purine to purine or pyrimidine to pyrimidine Transition Transversion = purine to pyrimidine How many possible transitions? transversions? p.38 “In animal nuclear DNA, ~ 60-70% of all point mutations are TRANSITIONS, whereas if random expect 33%”

4. Types of mutations - different aa specified by codon Missense mutation Nonsense mutation - change from sense codon to stop codon Non-synonymous - amino acid altered Synonymous - “silent” change 2. Insertions or deletions (“indels”) - frameshift mutations within coding sequences Fig. 1.12

5. Spontaneous Point Mutation Rates G – genome sizeµb – mutation rate per site per generationµg – genomic mutation rate per generation Table 4 in Drake et al. 1998, Genetics

6. Slippage and Short Indels Short insertions or deletions (short “indels”) eg. if slippage during DNA replication • rapid evolution change in copy number • of short tandem repeats microsatellites Fig.1.18

7. Normal and Thalassemia HBb 10 20 30 40 50 60 ----|----|----|----|----|----|----|----|----|----|----|----|-- Normal AUGGUGCACCUGACUCCUGAGGAGAAGUCUGCCGUUACUGCCCUGUGGGGCAAGGUGAACGU Thalass. AUGGUGCACCUGACUCCUGAGGAGAAGUCUGCCGUUACUGCCCUGUGGGGCAAGGUGAACGU ************************************************************** 70 80 90 100 110 120 --|----|----|----|----|----|----|----|----|----|----|----|---- Normal GGAUGAAGUUGGUGGU-GAGGCCCUGGGCAGGUUGGUAUCAAGGUUACAAGACAGG...... Thalass. GGAUGAAGUUGGUGGUUGAGGCCCUGGGCAGGUUGGUAUCAAGGUUACAAGACAGG...... **************** *************************************** • Are the two genes homologous? • What evolutionary change can you infer from the alignment? • What is the consequence of the evolutionary change?

8. Synonymous mutation = silent mutation? Do you agree or disagree with the following statement? see p.27 “A synonymous mutation may not always be silent.” Fig. 6.23

9. Triplet repeat disorder - increased copy number of tandem repeats of triplets within gene (or regulatory region) - certain human genetic (neurodegenerative) diseases - repeat number strongly correlates with age of onset of disease and severity DM1: Dystrophia myotonica-protein kinase, DMPK on Chr 19 DM2: ZNF9 gene on chromosome 3q21. HTT on chr 4q16.3 Repeat copy number in normal = red; orange = carrier; yellow = disease condition Gerald Karp 2007. Cell and Molecular Biology: Concepts and Experiments p.435 Category I: Huntington’s disease (HD) and the spinocerebellar ataxias, CAG in CDS. Category II: expansions tend to be more phenotypically diverse with heterogeneous expansions that are generally small in magnitude, but also found in the exons of genes. Category III: fragile X syndrome, myotonic dystrophy, juvenile myoclonic epilepsy, and Friedreich’s ataxia, non-CDS.

10. Fragile X Syndrome wt mutant male II-1 asymptomatic hemizygous carrier daughter III-1 asymptomatic, but expanded repeat in germ line Bassell GJ, Warren ST (2008). "Fragile X syndrome: loss of local mRNA regulation alters synaptic development and function". Neuron60 (2): 201–14. FMRP from FMR1

11. Huntington’s disease 4p16.3

12. Inversions, translocations, etc. Inversion through chromosome breakage & rejoining Fig. 1.20 - shown as single stranded, but both DNA strands inverted

13. Inversions, translocations, etc. Inversion - recombination between indirect repeats What would be outcome of recombination between direct repeats? Fig. 1.20

14. Deletion A B C D A D … … … … + See Fig. 1.17

15. “Hot spots” of mutation - short direct repeats, palindromes - alternating Pu-Py dimers (Z-DNA) - CpG in eukaryotes -deamination of C to U, repaired by uracil-DNA glycolyase - but 5-methyl C to T escapes repair patterns & positions of mutations not random Griffiths Fig. 7.16