Molecular Exercise Physiology Skeletal Muscle Hypertrophy Seminar 8 Henning Wackerhage

1. Molecular Exercise PhysiologySkeletal Muscle HypertrophySeminar 8Henning Wackerhage

2. Task Why was Robert Wadlow that tall? What would have happened if he had a defect in the IGF-1 gene?

3. Answer Why was Robert Wadlow that tall? Because he had an overexpression of growth hormone. What would have happened if he had a defect in the IGF-1 gene? IGF-1 is a second messenger for growth hormone. He would have been smaller.

4. Task There is evidence that athletes dope with growth hormone. Is growth hormone alone an effective treatment? Carry out a literature search.

5. Answer Claims for the anabolic effects of growth hormone: a case of the emperor's new clothes? Rennie MJ. Faculty of Life Sciences, Old Medical School, University of Dundee, Scotland, UK. m.j.rennie@dundee.ac.uk This review examines the evidence that growth hormone has metabolic effects in adult human beings. The conclusion is that growth hormone does indeed have powerful effects on fat and carbohydrate metabolism, and in particular promotes the metabolic use of adipose tissue triacylglycerol. However, there is no proof that net protein retention is promoted in adults, except possibly of connective tissue. The overexaggeration of the effects of growth hormone in muscle building is effectively promoting its abuse and thereby encouraging athletes and elderly men to expose themselves to increased risk of disease for little benefit.

6. Original IGF-1/somatomedin hypothesis Researchers noted that injected growth hormone induced protein synthesis in various tissues. In contrasts, if these tissues were incubated with growth hormone outside the body, then protein synthesis did not occur. The best explanation was that growth hormone induced an intermediate hormone (termed somatomedin and now IGF-1) that does would induce protein synthesis and growth. IGF-1 is mainly released by the liver (Le Roith et al. 2001). Growth hormone IGF-1 Growth

7. IGF-1 splice variants IGF-1Ec has been termed mechano-growth factor (MGF) to avoid (or increase?) confusion

8. Muscle IGF-1 induces muscle hypertrophy Coleman et al. (1995) generated transgenic mice where IGF-1 was overexpressed only in skeletal muscle. This led to large increases in the fibre area, indicating that IGF-1 could induce skeletal muscle hypertrophy. This confirmed that IGF-1 could act via an autocrine/paracrine mechanisms in skeletal muscle. IGF-1 IGF-1 Table. Fibre area in µm2 in control and IGF-1 muscle transgenic mice. Fibre type I IIa IId/x, IIb Control 675 1256 1975 IGF-1 muscle 1447 2435 3518 transgenic

9. What regulates muscle IGF-1 expression? Yang et al. (1996) found that stretch induced an increased expression of an IGF-1 splice variant which they termed mechano-growth factor (MGF). Stretch IGF-1 (MGF)

10. MGF and IGF in response to resistance exercise Figure a shows that MGF mRNA increases significantly only in young subjects in response to resistance. IGF-IEa does not change significantly. The data appear a bit inconclusive and it is unclear whether 2.5 h after resistance exercise was a time point where MGF/IGF-1 expression was highest (Hameed et al. 2003).

11. Anabolic steroids induce IGF-1 Nandrolone (nan, anabolic steroid) increases IGF-1 expression in rat skeletal muscle (Lewis et al. 2002).

12. Summary: Regulation of IGF-1 expression Proinflammatory cytokines (TNFa, Il-1) Food intake Resistance training Alternative splicing Tes GH GC ? ? IGF-1 The expression of the IGF-1 gene is activated by testosterone (tes), growth hormone (gh) and inhibited by glucocorticoids (gc). These hormones bind to their receptor; e.g. testosterone to the androgen receptor. Proinflammatory cytokines such as TNFa and interleukin-1 are increased in many situations associated with muscle wasting and inhibit IGF-1 expression (reviewed by Frost and Lang 2003).

13. Task IGF-1 is advertised as an anti-ageing treatment. Is IGF-1 alone effective in inducing muscle growth and why might it be advertised as an anti-ageing treatment?

14. Anwer GH/IGF-1 knockout animals appear to live longer. Animal models of genetic GH deficiencies such as Snell mice (Pit-1 gene mutations) the Ames mice (PROP-1 gene mutation) and the Laron mice (GH receptor gene knock-out) have a statistically significant higher longevity compared to normal controls. On the contrary, mice transgenic for GH and acromegalic patients secreting high amounts of GH have premature death. To better understand the role of the insulin-like receptors in mammalian lifespan regulation and ageing, we explored the phenotype of heterozygous IGF-I receptor (IGF1R) knockout mice. Compared with control littermates these mutants live longer without any obvious impairment of their health and physiology, except a reduced glucose tolerance that we observed in males.

15. Translation (3) During translation, an amino acid chain (peptide chain, protein) is synthesized by the ribosome. The mRNA serves as a template. (2) One amino acid corresponding to the anticodon is bound to tRNA (1) Transfer RNA (tRNA) has an anticodon that only binds to a particular mRNA codon AUCUUAACCUCCCCAGCAGCUGGGACUACAGCCACGCGCCACUGCAC mRNA

16. PKB pathway Researchers at the School of Life Sciences have made numerous contributions to elucidating the PKB pathway which is involved not also in mediating muscle hypertrophy but also cardiac hypertrophy, diabetes, cancer and many other growth situations. The key researchers on this pathway are shown below (I have probably omitted one or two). Before looking at the structure of the pathway, you will see the results of an experiment where PKB was activated on muscle to show that active PKB can cause hypertrophy. Dario Alessi Chris Proud Peter Downes Sir Philip Cohen

17. PKB activation causes hypertrophy PKB transfection In this experiment, an italian group of researchers have injected an activated PKB DNA constructs into a muscle and the construct has been taken up by the fibres that are stained light. PKB kinase activity was very high in these fibres and led to a dramatic hypertrophy compared to the much smaller fibres that are unstained (Pallafacchina et al. 2002).

18. The whole picture IGF-1 or insulin PI3K PDK1 PKB mTOR p70S6k P 4E-BP1 P S6 P Translation activation eIF4E P Ribosome Skeletal muscle fibre

19. Protein synthesis and p70 S6k responses are slow (b) (a) Rates of (a) protein synthesis and (b) p70 S6k activity in rat muscle in sedentary control (sed; open bars) and exercised (ex; solid bars) groups of rats studied after resistance exercise  (Hernandez et al. 2000). The data show that p70 S6k activity increases first after 6 h and that p70 S6k activity and protein synthesis are increased 12 and 24 after resistance exercise.

20. AMPK, amino acids and mTOR signalling IGF-1, insulin PKB High energy turnover, hypoxia Amino acids AMPK mTOR raptor Translation,protein synthesis Skeletal muscle fibre

21. Task Why might glucose increase protein synthesis?

22. Answer High glucose increases insulin which may stimulate protein synthesis.

23. Stimulating muscle growth via the PKB pathway: Doping and the clever way The message of all the slides is: If you manage to activate the PKB pathway, growth will occur. Some athletes try to activate the PKB pathway with doping agents. They are: 1) Human growth hormone (Is it effective? See Rennie 2003); 2) Insulin (see BBC report on next slide) 3) Clenbuterol (Katrin Krabbe) Obviously, testosterone and androgenic steroids will also affect IGF-1 expression in muscle and thus will probably affect the PKB pathway. The natural and clever way is resistance training (which increases MGF and possibly IGF-1) and protein (which, when digested will increase the amino acid concentration). However, the timing is important. Two papers suggest that the proteins have to be taken directly after resistance exercise.

24. Eat protein directly after resistance exercise! Cross-sectional area of quadriceps femoris Two groups of old subjects (70-80 years) performed a period of endurance training. Both groups received a gel containing 10 g protein (from skimmed milk and soybean), 7 g carbohydrate and 3.3 g lipid either directly after exercise (P0) or 2 h after exercise (P2). Only ingestion directly after exercise caused hypertrophy (Esmarck et al. 2001).

25. Muscle protein synthesis in response to amino acids In this important study by Cutherbertson, Smith and Rennie, young and elderly subjects were given up to 40 g of essential amino acids (EAA). The data show that the maximal rate of protein synthesis is lower in the elderly.

26. Task You can achieve a maximal stimulation of protein synthesis with 10 to 20 g of amino acids. How many eggs, pints of milk, steaks is that? Protein supplements are heavily advertised in body building magazines. Are high amounts of protein needed? Are they effective? Are they dangerous?

27. Answer You can achieve a maximal stimulation of protein synthesis with 10 to 20 g of essential amino acids. How many eggs, pints of milk, steaks is that? 10 g of EAA is roughly 20 g of total amino acids (and thus protein). 7 g of protein per egg 8 g per cup of milk 30 g fillet steak

28. (3) Autocrine, paracrine IGFs (4) Systemic IGFs IGF-1/MGF binding to receptor (5) PI3K (2) IGF-1 precursor splicing into IGF-1, MGF PDK1 (6) PKB (8) Amino acids (7) High energy turnover, hypoxia (1) Stretch, other signals AMPK mTOR raptor p70S6k 4E-BP1 P IGF promoter (10) Translation of ribosomal proteins S6 P (9) eIF3 and translation activation eIF4E Nucleus P Peptide/protein Ribosome Skeletal muscle fibre

29. The End