Genetically Modified Foods

1. Genetically Modified Foods Siddhartha Mitra AID – NYC April 2010

2. Topics Covered Background Definitions Effects Advantages Disadvantages Evidence Future Direction Questions

3. Background Bt Brinjal, India’s (and the world’s) first genetically modified food crop has been temporarily stopped in India, thanks to a massive grassroots campaign. Bt Cotton, however, is being cultivated in many parts of India. Benefits are doubtful, though Doubts exist about its productivity, and has been implicated with negative effects, like resistant test, high water consumption, farmer suicides, etc.

4. Definition What does Bt stand for? Bt stands for Bacillus thuringiensis, which is a natural soil bacteria, which secretes a toxin that is deadly to two pests - fruit and shoot borer (FSB, Leucinodes orbonalis) and fruit borer (Helicoverpa armigera). Eggplant borer : Helicoverpaarmigera Cotton bollworm: Leucinodesorbonalis

5. Definition What is a genetic modification? Insertion of Bt gene in the Brinjal genetic code Produce the Bt Toxin to kill the pest But is only the gene introduced? No, a PROMOTER and an antibiotic resistance MARKER GENE are also introduced!

6. Definition What is a gene What is genetic modification How is it done Potential effects

7. Definition Gene – part of a chromosome Looks like AACCGGCCCTTTTACGTTATTA Chromosomes Part of it is a gene AACCGGCCCTTTTACGTTATTA Genes

8. DefinitionGenes produce protein Cell Protein Nucleus Genetic material The genes in the genetic code have the template for creating the proteins Proteins (extracellular, cell surface, or intracellular) confer behaviour – the phenotype

9. DefinitionProtein production occurs at specific times and places GENE EXPRESSION: A gene creates proteins only at specific times and locations in an organism, and in very tightly regulated amounts. Example: Pancreatic cells have genes for producing the insulin protein, and so do cells in the eye. Specific location Specific amount Specific time Expression is tightly regulated

10. DefinitionRegulation How does regulation occur? For a gene to be expressed, specific chemical factors need to bind to a PROMOTER region and other regulatory region in the genetic code upstream of the gene. AAACCGGTATAATCCCCTGAGTTTGCCGTTAGTAG Factor binds promoter Gene Regulatory region Factor binds regulatory region Promoter

11. DefinitionRegulatory region Therefore a gene is expressed only when specific agents bind to promoter and regulatory regions at specific time and at specific cell types (eye cell vs pancreatic cell). Though promoter sequence are known, information about regulatory regions and what factors binds to them is mostly unknown.

12. Definition BT Gene insertion A BT modified brinjal has a BT gene inserted, along with a promoter element(Cauliflower Mosaic Virus (CaMV)promoter) The promoter is so powerful that it keeps the BT gene expression turned on at full volume at all times in BT Brinjal! This could lead to metabolic stress as the plant has to keep producing this toxin despite the external conditions.

13. Definition BT Gene insertion A BT modified brinjal has a BT gene inserted, along with a promoter element(Cauliflower Mosaic Virus (CaMV)promoter) ACTGTCTATGTA + TACGTATAATGGTAGATTTATATGGG TAACTGTCTATGTACGTATAATGGTAGATTTATATGGG Insertion point Gene BT Gene BT Gene Promoter Promoter

14. Definition Insertion process The insertion is carried out using an mobile microbial DNA which infects the host cell (for dicotyledons like lugumes, or by a gene gun (gold pellets carrying fragments of DNA), either which performs the random insertion in some of the target cells. Microbial Vector Target cell Create primary transformant Target cell Gene gun Target cell

15. Definition BT Gene insertion Microbial Vector has the genetic sequence of toxin present in a part of an insertion sequence. AACCGTGGTGGGTCCCAATTAGGGTTACCGGGG The gene gun shoots gold pellets having the sequence of interest AACGTTCCGTT Gold Pellet

16. Definition Result of insertion process Target cell Target cell Target cell Only some of the target cells successfully incorporate the gene To identify the successfully converted viable cells, an antibiotic resistance marker gene IS ALSO INSERTED

17. DefinitionResistance marker gene AACCGGTTGGTTGGGTTTGGGGGGGCCGGTTAAA Insertion sequence Promoter Sequence Bt gene Resistance marker gene The target cells which successfully incorporate the insert sequence are selected on the basis of their resistance to an antibiotic

18. Definition Result of insertion process Target cell Antibiotic Target cell Target cell Only target cells survive based on resistance to antibiotics Target cell

19. Definition Create final hybrid variety Primary transformant bacterial plasmid DNA (pMON10518) Hybrid variety MHB 4, 9, 10, 80, 99 Backcross Final variety Bt MHB Final variety needs high amounts water and fertilisers .

20. Effects Jumping gene (plants) Transformation-induced “unexpected” changes might lead to unexpected production of toxins, allergens, carcinogens (rotenone – Parkinson’s) or teratogens in the transformed cells. Domingo, J.L., Toxicity Studies of Genetically Modified Plants, Critical Rev Food Sc and Nutrition 47: 721-33 (2007) Transgene-vector recombinant DNA had the capacity of ‘jumping into' alien species, it could also ‘jump out' of a transgenic crop and ‘jump into' another species causing gene contamination. Random insertion Antibiotic marker Can confer antibiotic resistance to gut bacteria and other organisms. Jumping gene (animals) Evidences are now available that show that DNA from GM plants can survive in the human gastrointestinal tract. Netherwood,T. et al Nature Biotechnology  22, 204 - 209 (2004)

21. Advantages? Yield not shown to increase in Bt Cotton or GM Soy Mahyco admits unable to control pests in Gujarat with Bt Cotton Increase use of pesticides Increased use of water for Bt cotton

22. Disadvantages Could lead to genetic contamination Farmers suicides have doubled in Bt cotton belt in Vidarbha Monoculture will wipe out diversity Will make us dependent on Monsanto for food

23. Evidence Long terms lab tests on rats have all shown ill-effects Monsanto made tests only on few rats (10) for only 3 months Long term human tests not done Monsanto / Mahyco uses their own datasets to show yield increase

24. Evidence • Non-target effects of GM food crops • 21 reported harmful environmental effects; • 44 reported unexpected changes in plant physiology; • 20 reported unpredicted changes in plant morphology; • 6 reported a decrease in the food or feed quality • 4 reported scrambling of both the transgene and host DNA • Effect on animals • Arpad Putszai paper in the Lancet, showed the unpredicted changes • in the gastro-intestinal mucosa of rats fed with GM potato; • A 90-day internal company study on rats fed with MON863 Bt-maize showed • decreased body-weight and severe toxic effects in the liver and kidneys; • (c) a 20-week feeding study by the Austrian Federal Ministry of Health revealed • lower fertility and reduced birth weight in mice fed with Bt-maize; • (d) a study carried out in the Italian government’s National Institute of Research on Food and Nutrition showed that very young and old mice fed with Bt-maize (MON810) for 90 days were immunologically compromised

25. Future DirectionsDo we really need this? We already have varieties Negative effects on farmers Danger to consumers Benefit to corporations

26. Future Directions Tissue specific expressions (instead everywhere like root) Site-directed, non-random insertion (Gene stacking Golden rice) Use safer promoters (CaMV promoter aggressive, similarity to HIV) Chlorpolast transformation (instead of nuclear transformation)

27. Future Directions GM potato, tomato, rice, everything in the waiting Control of food for the world Loss of diversity will make crops susceptible BRAI act will make it illegal for ‘non-scientists’ to question GM

28. References Questions or comments? Crop management – yield increase of 28% with better crop management Yield increase – 3-4% on average

29. Questions Questions or comments?