1 / 20

DNA, RNA, Mutations

DNA, RNA, Mutations. Objective 2: 6a,b,c Biology: DNA, RNA, Mutation The student knows the structures and functions of nucleic acids in the mechanisms of genetics. The student is expected to:

oro
Download Presentation

DNA, RNA, Mutations

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. DNA, RNA, Mutations

  2. Objective 2: 6a,b,c Biology: DNA, RNA, Mutation The student knows the structures and functions of nucleic acids in the mechanisms of genetics. The student is expected to: • (A) describe components of deoxyribonucleic acid (DNA), and illustrate how information for specifying the traits of an organism is carried in the DNA; • (B)explain replication, transcription, and translation using models of DNA and ribonucleic acid (RNA); • (C) identify and illustrate how changes in DNA cause mutations and evaluate the significance of these changes

  3. P P P P D D T T A D D D D D D C C G G G P P P P A D P P D C Remember THIS? Making a DNA copy of DNA is replication. Cells need to copy their DNA for mitosis(growth, repair, and maintenance). Daughter cells are genetically identical. DNA is also copied for meiosis(reproduction). Daughter cells are genetically different and have ½ the # of chromosomes.

  4. DNA is made of building blocks called nucleotides. They consist of a deoxyribose sugar, a phosphate group and a nitrogen base. The bases are adenine, thymine, guanine, and cytosine. Phosphate group Deoxy-ribose Nitrogen Base

  5. RNA is made of building blocks called nucleotides. They consist of a ribose sugar (instead of a deoxyribose sugar), a phosphate group and a nitrogen base. The bases are adenine, uracil, guanine, and cytosine. Phosphate group ribose Nitrogen Base

  6. What's the difference? DNA RNA Both have adenine, guanine, and cytosine as bases Sugar: ribose Sugar: Deoxyribose Has the base thymine Both have a sugar phosphate backbone. Has the base uracil

  7. Three Types of RNA There are three types of RNA: mRNA-messenger (transcribes DNA) tRNA-transfer (translates mRNA) rRNA-ribosomal (used as a machine for translation)

  8. REPLICATION : DNA copies DNA A T G C http://www.johnkyrk.com/DNAreplication.html http://nobelprize.org/chemistry/educational/dna/b/replication/dna_compounds.html

  9. TRANSCRIPTION: mRNA copies DNA A U G C T A http://www.johnkyrk.com/DNAtranscription.html

  10. TRANSLATION: mRNA is decoded and a protein is made from amino acids. A U G C http://www.johnkyrk.com/DNAtranslation.html

  11. MUTATION: Any change in the DNA sequence. If it is a point mutation (one letter is changed), it can change the amino acid sequence by changing the code. ATC ATG Deletion Point mutation

  12. DNA mRNA Protein In nucleus On ribosome Translation Transcription ATGTGGCAG Let’s try it: 1. Write this DNA base pair sequence on you paper. 2. Write the complementary strand of DNA that would bond to them. 3. Translate the strand into mRNA. 4. List the amino acids that these codons stand for. Use the amino acid chart on the next slide.

  13. A-T-G-T-G-G-C-A-G- T Complementary strand that would form in Replication. A C A C C G T C

  14. T-A-C-A-C-C-G-T-C- AUGUGGCAG Methionine Peptide Bonds Tryptophan Glutamine DNA mRNA Amino Acids Transcription Translation

  15. You try it!!! ATGCCATTCAATTAACCCTCC 1. Write this DNA base pair sequence on you paper. 2. Write the complementary strand of DNA that would bond to them. 3. Translate the strand into mRNA. 4. List the amino acids that these codons stand for.

  16. Solution

  17. Sites to Visit DNA Simulation http://www.johnkyrk.com/DNAanatomy.html Interactive DNA Workshop http://www.pbs.org/wgbh/aso/tryit/dna/index.html

More Related