1 / 58

Biotechnology and Human Disease (Molecular Basis of Inherited Diseases)

Biotechnology and Human Disease (Molecular Basis of Inherited Diseases). Outline Restriction endonucleases DNA cloning Probes Southern Blotting Restriction Fragment Length Polymorphism Polymerase chain reaction Analysis of gene expression Gene therapy Transgenic animals

raypeterson
Download Presentation

Biotechnology and Human Disease (Molecular Basis of Inherited Diseases)

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Biotechnology and Human Disease (Molecular Basis of Inherited Diseases)

  2. Outline • Restriction endonucleases • DNA cloning • Probes • Southern Blotting • Restriction Fragment Length Polymorphism • Polymerase chain reaction • Analysis of gene expression • Gene therapy • Transgenic animals • Biopharmaceuticals

  3. OVERVIEW • The entire sequence of the human genome is now known. This effort is called the Human Genome Project, with the help of:. • Restriction endonucleases: this permits the dissection of huge DNA molecules into defined fragments. • Cloning techniques: for amplification of specific nucleotide sequences. • Synthesis of specific probes: for identification and manipulation of the sequence of interest. • These techniques allow the identification of both normal and mutant sequences in DNA, leading to the development of methods for: Prenatal diagnosis of genetic diseases and Treatment of patients by gene therapy.

  4. RESTRICTION ENDONUCLEASES • Restriction endonucleases (restriction enzymes):Bacterial enzymes that cleave double-stranded DNA into smaller, more manageable fragments • Each enzyme cleaves DNA at a specific palindromic nucleotide sequence (4-6bp), producing restriction fragments. • DNA sequence that is recognized by a restriction enzyme is called restriction site • These enzymes form either staggered cuts (sticky or cohesive ends) or blunt end cuts on the DNA • Bacterial DNA ligases can anneal two DNA fragments from different sources if they have been cut by the same restriction endonucleasethe hybrid combination of two fragments is called a recombinant DNA molecule

  5. This means, within a short region of the double helix, the sequence on the "top" strand, read 5 3, is identical to that of the "bottom" strand, also read in the 5 3 direction. Specificity of restriction endonucleases

  6. Nomenclature According to the organism from which the enzyme was isolated: • The 1st letter of the name from the genus of the bacterium. • The next 2 letters (from the type or strain). • A final number: to indicate the order in which the enzyme was discovered in that organism. Ex.: HaeIII is the third restriction endonuclease isolated from the bacterium Haemophilusaegyptius. TaqI is the first restriction endonuclease isolated from the bacterium Thermus aquaticus.

  7. "Sticky" and "blunt" ends: • These enzymes cleave DNA to produce a 3-OH group on one end and a 5-phosphate group on the other. • Some of them (ex: TaqI)  form staggered cuts that produce "sticky" or cohesive ends (gives DNA fragments with complementary single-stranded sequences). • Others, (ex: Haelll) cleave in the middle of their recognition sequence (i.e., at the axis of symmetry) to produce fragments with "blunt" ends that do not form H-bonds with each other.

  8. "Sticky" and "blunt" ends: • Using DNA Ligase, sticky ends of a DNA fragment can be covalently jointed with other DNA fragments with sticky ends produced by the same restriction enzyme. • The hybrid combination of the 2 fragments is a recombinant DNA molecule. • Another Ligase encoded by bacteriophage T4 can covalently join blunt-ended fragments.

  9. DNA CLONING The introduction of a foreign DNA molecule into a replicating cell for amplification (production of many copies) of the DNA • The total cellular DNA is cleaved with a specific restriction enzyme to give 100,000s of fragments • Each fragment is ligated to a DNA vector (cloning vector) to form a hybrid molecule. • Hybrid recombinant DNA molecule transfers its DNA fragment into a single host cell (ex: bacterium) for replication (amplification). • Then the host cell multiplies forming a clone in which each cell carries copies of the same inserted DNA fragment (cloning). • The cloned DNA is released from its vector by cleavage using the appropriate restriction endonuclease, then isolation

  10. Vectors: • A vector is a molecule of DNA to which the fragment of DNA to be cloned is joined. • Commonly used vectors: plasmids. and bacterial and animal viruses • Essential properties of a vector include: • It must be capable of autonomous (independent) replication within a host cell. • It must contain at least one specific nucleotide sequence recognized by a restriction endonuclease. • It must carry at least one gene that confers the ability to select for the vector such as an antibiotic resistance gene.

  11. Prokaryotic plasmids: • The small, circular, extra chromosome DNA. • Plasmid may: • carry antibiotic resistance genes • facilitate the transfer of genetic information from one bacterium to another. • be isolated from bacterial cells and cleaved at specific sites by restriction endonucleases, and foreign DNA is inserted. • The hybrid plasmid can be reintroduced into a bacterium for amplification (large number of copies of the plasmid containing the foreign DNA)

  12. DNA libraries: • A DNA library is a collection of cloned restriction fragments of the DNA of an organism. • There are two kinds of libraries: genomic libraries an cDNA libraries. • Genomic libraries contain a copy of every DNA nucleotide sequence in the genome, while cDNA libraries contain DNA sequences that appear as mRNA molecules and these differ from one cell type to another. • Cloned cDNAs lack introns and the controlregions of the genes, whereas these are present in genomic libraries.

  13. Genomic DNA libraries: • It is the collection of fragments of double-stranded DNA obtained by digestion of the total DNA of the organism with a restriction enzyme. • Ligation of the fragments to a vector. • The recombinant DNA molecules are replicated within host bacteria. • The amplified DNA fragments represented the entire genome of the organism and are called a genomic library.

  14. Complementary DNA (cDNA) libraries: • Using mRNA as a template to make a complementary double-stranded DNA (cDNA) using the enzyme reverse transcriptase. • The resulting cDNA is a double-stranded copy of mRNA. • cDNA can be amplified by cloningor by polymerase chain reaction. • It can be used as a probe to locate the gene that coded for the original mRNA (or fragments of the gene) in mixtures containing many unrelated DNA fragments.

  15. cDNA libraries • If the mRNA used as a template is a mixture of different species, the resulting cDNAs are heterogenous and cloned to form a cDNA library. • cDNA has no intervening sequences (introns and control regions), it can be cloned into an expression vector for the synthesis of eukaryotic proteins by bacteria. • Expression vectors are plasmids containing a bacterial promoter for transcription of the cDNA, and a Shine-Dalgarno sequence for translation of the resulting mRNA by bacterial ribosome.

  16. Sequencing of cloned DNA fragments: • Sanger dideoxy method: is a procedure used to determine the base sequence of DNA fragments that have been cloned and purified. • The Human Genome Project used highly automat variations of this technique to determine the base sequence of the entire human genome • Procedure: • The single-stranded DNA to be sequenced is used as the template for DNA synthesis by DNA polymerase. • A radioactive primer complementary to the 3-end of the target DNA is added along with the four deoxyribonucleoside triphosphates (dNTPs).

  17. Sequencing of cloned DNA fragments • Divide the sample into 4 rxn tubes and add to each one a small amount of one of the 4 dideoxy ribonucleoside triphosphate (ddNTPs). Because ddNTPs contain no 3-OH group, incorporation of a ddNTPs into a newly synthesized strand terminates its elongation. • The products of this reaction is a mixture of DNA strands of different lengths, each terminating at a specific base. • Separation of DNA products by size using polyacrylamide gel electrophoresis • Autoradiography; yields a pattern of bands from which the DNA sequence can be read.

  18. OH Phosphate NH2 HO O P Base N N O N N CH2 5’ O 4’ 1’ Sugar 3’ 2’ OH H H 2’3’-dideoxynucleotide monophosphate Dideoxynucleotides 2’-dideoxynucleotide monophosphate • DNA Sequencing using the Sanger method involves the use of 2’3’-dideoxynucleotide triphosphates in addition to regular 2’-deoxy nucleotide triphosphates • 2’3’-dideoxynucleotide triphosphates lack a 3’ OH group, and DNA polymerization occurs only in the 3’ direction, once 2’3’-dideoxynucleotide triphosphates are incorporated, primer extension stops

  19. CH3 O H OH HN N OH NH2 O P HO O O CH2 N N O O N N CH2 O OH P O OH NH2 B A S E S H O N H2N H O H P HO O N O N N NH 2’3’dideoxynucleotide O SUGAR-PHOSPHATE BACKBONE N N O H2O NH2 N O O CH2 N O CH2 N O HN N O HO P H2N H O O H H P HO O O CH2 O O CH2 O O HO P OH H HO 2’3’dideoxy-nucleotidesTerminateDNAReplication

  20. DNA Sequencing • In DNA sequencing reactions all the basic components needed to replicate DNA are used • 4 reactions are set up, each containing: • DNA Polymerase • Primer • Template to be sequenced • dNTPs • A small amount of one ddNTP ddATP, ddCTP, ddGTP, ddTTP • As incorporation of ddNTPs terminates DNA replication, a series of fragments is produced all terminating with the ddNTP that was added to each reaction

  21. Cloned fragment Primer Primer Binding sites DNA Sequencing Plasmid (or phage) with cloned DNA fragment

  22. Pol. Pol. Pol. Pol. 5’TTATCGTACCATGACTAGA 5’TTATCGTACCATGA 5’TTATCGTA 5’TTATCGTACCATGACTAGATGCGATA Let me Through! Oh come on! Not Again! Agggg…. 5’TTATCGTACCA 5’TTATCGTACCATGACTA 5’TTATCGTACCATGACTAGATGCGA The ddATP Reaction 3’AATAGCATGGTACTGATCTTACGCTAT5’ 5’TTATCG 5’TTATCGTA 5’TTATCGTACCATGA 5’TTATCGTACCATGACTAGA 5’TTATCGTACCATGACTAGATGCGATA

  23. ddATP ddCTP ddGTP ddTTP Read 5’ to 3’ from bottom to top DNA Sequencing • Products from 4 reactions each containing a small amount of a dideoxynucleotide are loaded onto a gel • Polyacrlyamide gels capable of separating fragments differing in size by only one base • High concentrations of urea are used to prevent formation of double stranded DNA or secondary structures • Because polymerization goes 5’ to 3’ shortest fragments are 5’ compared to longer fragments which are in the 3’ direction

  24. A C G T DNA SequencingWhat A SequencingAutorad ActuallyLooks Like • To read the autorad it is important to start at the bottom and work up so that it is read in the 5’ to 3’ direction 5’CTAGAGGATCCCCGGGTACCGAGCT...3’

  25. PROBES • Probe: is a single-stranded piece of DNA, labeled with a radioisotope (e.g. 32P) or with a non-radioactive probe, (e.g. biotin). • The nucleotide sequence of a probe is complementary to the target DNA. • Probes are used to identify which clone of a library or which band on a gel contains the target DNA. Hybridization of a probe to DNA fragments: • The utility of probes depends on the phenomenon of hybridization. • Hybridization: is a process in which a single-stranded sequence of a target DNA binds to a probe of a complementary nucleotide sequence (DNA probe-target DNA hybrid duplex)

  26. Hybridization of a probe to DNA fragments • ssDNA is produced by alkaline denaturation of dsDNA. • This ssDNA is first bound to a nitrocellulose membrane to prevent self-annealing. (DNA immobilization). • The immobilized DNA strands are available for hybridization to an exogenous, single-stranded complementary, radio labeled DNA probe. • The extent of hybridization is measured by the retention of radioactivity on the membrane. • Excess probe molecules that do not hybridize are removed by washing the filter and so do not interfere.

  27. Synthetic oligonucleotide probes • If the sequence of all or part of the target DNA is known, single stranded oligonucleotide probes of 20-30 nucleotides can be synthesized that are complementary to a small region of the gene of interest. • If the sequence of the gene is unknown, the amino acid sequence of the protein-that is the gene product-may be used to construct a probe. Short, single-stranded DNA sequences (15-30 nucleotides) are synthesized, using the genetic code as a guide. • Because of the degeneracy of the genetic code  synthesize several oligonucleotides.

  28. Detecting the ßS-globin mutation Allele-specific oligonucleotide (ASO) probe can be used to detect the presence of the sickle cell mutation in the ß-globin gene. • DNA, isolated from white blood cells, is denatured into single strands. • An oligonucleotide is constructed that is complementary to the portion of the mutant globin gene coding for the amino-terminal sequence of the ß-globin protein. • Thus, a double-stranded hybrid forms that can be detected by electrophoresis. .

  29. Detecting the ßS-globin mutation • DNA isolated from a heterozygous individual (sickle cell trait) or a homozygous patient (sickle cell disease) contains a nucleotide sequence that is complementary to the probe • DNA obtained from normal individuals is not complementary at the sixth codon (coding for glutamate in normal individuals but for valine in patients with the ßS-gene) and, therefore, does not form a hybrid

  30. Use of a pair of such ASOs (one specific for the normal allele and one specific for the mutant allele) allows one to distinguish the DNA from all three possible genotypes-homozygous normal, heterozygous, and homozygous mutant.

  31. Biotinylated probes • Because the expensive disposal of radioactive waste, non-radioactive probes have been developed. The vitamin biotin, can be chemically coupled to the nucleotides used to synthesize the probe. Biotin binds very tenaciously to avidin-a readily available protein contained in chicken egg whites • Avidin can be attached to a fluorescent dye detectable optically with great sensitivity. • Thus, a DNA fragment (displayed by gel electrophoresis) that hybridizes with the biotinylated probe is made visible by immersing the gel in a solution of dye-coupled avidin. After washing away the excess avidin, the DNA fragment that binds the probe is fluorescent.

  32. SOUTHERN BLOTTING • A technique that detects mutations in DNA. It combines the use of restriction enzymes and DNA probes. • Named after its inventor Edwards Southern • Procedure (fragmentation electrophoresis detection) • DNA (entire genomic) is extracted from leukocytes and cleaved using a specific restriction enzymemillion of fragments • Resulting fragments are separated on the basis of size by electrophoresis (larger is slower, smaller is faster)and their lengths are determined in bp • DNA fragments in gel are denatured and transferred to nitrocellulose membrane • A specific probe hybridization helps to visualize DNA fragments of interest

  33. RESTRICTION FRAGMENT LENGTH POLYMORPHISM • Genome variations are differences in the sequence of DNA among individuals. They include both polymorphisms and mutations. • A polymorphism is a clinically harmless DNA variation. It often occurs in the intervening sequences that do not code for proteins • Mutation refers to an infrequent potentially harmful genome variation that is associated with a specific human disease. • A restriction fragment length polymorphism (RFLP) is a genetic variant that can be examined by cleaving the DNA into fragments (restriction fragments) with a restriction enzyme. The length of the restriction fragments is altered if the genetic variant alters the DNA so as to create or abolish a restriction site In either case, cleavage with an endonuclease results in fragments of lengths differing from the normal ( more or fewer), which can be detected by DNA hybridization

  34. Two DNA variations commonly resulting in RFLPs: • Single base changes in DNA: • About 90% of human genome variation comes in the form of single nucleotide polymorphisms, or SNPs (pronounced "snips"), that is, variations that involve just one base. • The alteration of one or more nucleotides at a restriction site can render the site unrecognizable by a particular restriction endonuclease. A new restriction site can also be created by the same mechanism. • In either case, cleavage with an endonuclease results in fragments of lengths differing from the normal, which can be detected by DNA hybridization

  35. 2. Tandem repeats: Polymorphism in chromosomal DNA can arise from the presence of a variable number of tandem repeats. These are short sequences of DNA at scattered locations in the genome, repeated in tandem (like freight cars of a train). • The number of these repeat units varies from person to person, but is unique for any given individual and, therefore, serves as a molecular fingerprint. • Cleavage by restriction enzymes yields fragments that vary in length depending on how many repeated segments are contained in the fragment. • Variations in the number of tandem repeats can lead to polymorphism.

  36. Prenatal diagnosis Families with a history of severe genetic disease, may wish to determine the presence of the disorder in a developing fetus by prenatal diagnosis. Many methods are available but molecular analysis of fetal DNA promises to provide the most detailed genetic picture. Direct diagnosis of sickle cell disease is preformed using RFLPs

  37. Normal b-globin DNA Mutant b-globin DNA C T T C A T G A A G U A mRNA mRNA Normal b-globin Mutant b-globin Glu Val O O H2N H2N C C C C OH OH H H CH2 CH CH3 H2C H3C OH C Neutral Non-polar Acid O The Sickle Cell Anemia Mutation

  38. Direct diagnosis of sickle cell disease using RFLPs: • The genetic disorders of hemoglobin are the most common genetic diseases in humans. • In the case of sickle cell disease, the mutation that gives rise to the disease is actually one and the same as the mutation that gives rise to the polymorphism. Direct detection by RFLPs of diseases that result from point mutations is at present limited to only a few genetic diseases. • Sickle cell anemia is caused by a point mutation. The sequence altered by the mutation abolishes the recognition site of the restriction endonuclease MstII that recognizes the nucleotide sequence CCTNAGG (where N is any nucleotide). • Thus, the A to T mutation within a codon of the s-globin gene eliminates a cleavage site for the enzyme.

  39. RFLP analysis • Sickle cell anemia is caused by a point mutation (A to T mutation (base substitution) within a codon of the s-globin gene). The sequence altered by the mutation abolishes the recognition site CCTNAGG (where N is any nucleotide). of the MstII restriction endonuclease • Normal DNA digested with MstII yields a 1.15 kb fragment, whereas a 1.35 kb fragment is generated from the ßs gene as a result of the loss of one MstII cleavage site. • Diagnostic techniques for analyzing fetal DNA provide safe,early detection of sickle cell anemia, as well as other genetic diseases.

  40. POLYMERASE CHAIN REACTION(PCR) • PCR is a test tube method for amplifying a selected DNA sequence that does not rely on the biologic cloning method. • PCR permits the synthesis of millions of identical copies of a specific nucleotide sequence in a few hours. • The method can be used to amplify DNA sequences from any source-bacterial, viral, plant, or animal. • PCR is an artificial way of doing DNA replication. PCR uses DNA polymerase to repetitively amplify target DNA • Each cycle of amplification doubles the amount of DNA in the sample, leading to an exponential increase in DNA with repeated cycles of amplification

  41. Function PCR Components of a PCR Reaction • Buffer (containing Mg++) • Template DNA • 2 Primers that flank the fragment of DNA to be amplified • dNTPs • Taq DNA Polymerase (or another thermally stable DNA polymerase) How The Functions Of Replication Are Achieved During PCR • Melting DNA • Heat • Polymerizing DNA • Taq DNA Polymerase • Providing primer • Primers are added to the reaction mix 43 • Joining nicks • N/A as fragments are short 43

  42. 30x Melting Melting 100 94 oC 94 oC Extension Annealing Primers 72 oC Temperature 50 50 oC 0 T i m e 3’ 3’ 3’ 3’ 5’ 5’ 5’ 5’ 5’ 5’ 5’ 3’ 5’ 5’ 3’ 5’ 5’ 3’ 5’ 5’ 5’ 5’ 5’ 3’ 3’ 3’ PCR

  43. Melting 100 94 oC Temperature 50 0 T i m e 3’ 5’ 5’ 3’ PCR

  44. 30x Melting Melting 100 94 oC 94 oC Extension Annealing Primers Temperature 72 oC 50 oC 50 3’ 5’ 0 5’ T i m e 5’ 5’ 3’ 5’ 5’ 5’ 5’ 5’ 5’ 5’ 5’ PCR

  45. 30x Melting Melting 100 94 oC 94 oC Extension Annealing Primers Temperature 72 oC 50 oC 50 3’ 5’ 0 5’ T i m e 5’ 5’ 3’ 5’ 5’ 5’ Fragmentsof defined length 5’ 5’ 5’ 5’ 5’ PCR

  46. Number 1 2 4 8 16 32 64 0 Cycles 1 2 3 4 5 6 DNA Between The Primers Doubles With Each Thermal Cycle

  47. Steps of a PCR • Primer construction: synthetic oligonucleotide (20-35 NMP) single stranded and complementary to the Flanking sequences -nucleotide sequence on each side of the target DNA .The 3'-hydroxyl end of each primer points toward the target sequence. • Denature the DNA: The DNA to be amplified is heated to separate the double-stranded target DNA into single strands. • Annealing of primers to single-stranded DNA: The separated strands are cooled and allowed to anneal to the two primers (one for each strand). • Chain extension:DNA polymerase adds deoxyribonucleotides (within reaction mixture in excess) to the 3'-hydroxyl end of the primer, and strand growth –complementary antiparallel-extends across the target DNA.

  48. Steps of a PCR • At the completion of one cycle of replication, the reaction mixture is heated again to denature the DNA strands (of which there are now four). and the cycle of chain extension is repeated. • Thus, each newly synthesized polynucleotide can act as a template for the successive cycles. This leads to an exponential increase in the amount of target DNA with each cycle, hence, the name "polymerase chain reaction” • By using a heat-stable DNA polymerase (for example, Taq polymerase) from a thermophilic bacterium, the polymerase is not denatureddoes not have to be added at each successive cycle. • Each extension product of the primer includes a sequence complementary to the primer at the 5' end of the target sequence. • Advantages o PCR:sensitivity (target DNA is less than 1 part in a 106 of the initial sample)and speed ( as compared to recombinant DNA cloning technology)

More Related