1 / 31

Introduction to Synthetic Biology

Introduction to Synthetic Biology. Dannenberg and Purdy 2012 (Tokos edits 2012). What is Synthetic Biology?. https://www.youtube.com/watch?v=rD5uNAMbDaQ. ELECTRICAL engineering solution. water = weight water<weight. MECHANICAL engineering solution. BIOLOGICAL engineering solution.

regan-conway
Download Presentation

Introduction to Synthetic Biology

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Introduction to Synthetic Biology Dannenberg and Purdy 2012 (Tokos edits 2012)

  2. What is Synthetic Biology? • https://www.youtube.com/watch?v=rD5uNAMbDaQ

  3. ELECTRICAL engineering solution

  4. water = weight water<weight MECHANICAL engineering solution

  5. BIOLOGICAL engineering solution

  6. BIOLOGICAL engineering solution

  7. Genetic Engineering rDNA Sequencing PCR

  8. A LIVING HOUSE - Terreform’s Fab Tree Hab

  9. How is Synthetic Biology Different? Synthetic biology uses four principles not typically found in genetics, genomics, or molecular biology: abstraction, modularity, standardization, and design and modeling.

  10. Abstraction: • Abstraction - you can use parts/devices/systems without having to worry about how they work. • DNA makes parts. • Parts into devices. • Devices connected to make systems.

  11. Modularity: • parts, devices and systems - connected as self-contained units and combined in any combination you want

  12. Standardization: • All the “Tab A’s” fit into all the “Slot B’s.” • An everyday example - all light bulbs fit into any socket!

  13. Designing and modeling • build a model • test the devices capacity • improves design • tests basic biological assumptions that could be false

  14. Registry of Standard biological Parts • http://partsregistry.org/Main_Page

  15. DNA is DNA • E. Coli is our chassis • Can use parts from any organism • Can use parts made by a computer

  16. Abstraction Hierarchy a human invention designed to assist people in engineering complex systems Assemblies of devices make a system Assemblies of parts make up devices Sequences of DNA encode “parts”

  17. “Part” – sequence of DNA with human defined function AAAATGCACCCGCTGTCGATCAAACGCGCGGTGGCGAATATGGTGGTCAACGCCGCCCGTTATGGCAATGGCTGGGTCAAAGTCAGCAGCGGAACGGAGCCGAATCGCGCCTGGTTCCAGGTGGAAGATGACGGTCCGGGAATTGCGCCGGAACAACGTAAGCACCTGTTCCAGCCGTTTGTCCGCGGCGACAGTGCGCGCACCATTAGCGGCACGGGATTAGGGCTGGCAATTGTGCAGCGTATCGTGGATAACCATAACGGGATGCTGGAGCTTGGCACCAGCGAGCGGGGCGGGCTTTCCATTCGCGCCTGGCTGCCAGTGCCGGTAACGCGGGCGCAGGGCATGACAAAAGAAGGGTAATCTAGAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGCC

  18. Parts assembled into Devices AAAATGCACCCGCTGTCGATCAAACGCGCGGTGGCGAATATGGTGGTCAACGCCGCCCGTTATGGCAATGGCTGGGTCAAAGTCAGCAGCGGAACGGAGCCGAATCGCGCCTGGTTCCAGGTGGAAGATGACGGTCCGGGAATTGCGCCGGAACAACGTAAGCACCTGTTCCAGCCGTTTGTCCGCGGCGACAGTGCGCGCACCATTAGCGGCACGGGATTAGGGCTGGCAATTGTGCAGCGTATCGTGGATAACCATAACGGGATGCTGGAGCTTGGCACCAGCGAGCGGGGCGGGCTTTCCATTCGCGCCTGGCTGCCAGTGCCGGTAACGCGGGCGCAGGGCATGACAAAAGAAGGGTAATCTAGAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGCC

  19. Parts assembled into Devices AAAATGCACCCGCTGTCGATCAAACGCGCGGTGGCGAATATGGTGGTCAACGCCGCCCGTTATGGCAATGGCTGGGTCAAAGTCAGCAGCGGAACGGAGCCGAATCGCGCCTGGTTCCAGGTGGAAGATGACGGTCCGGGAATTGCGCCGGAACAACGTAAGCACCTGTTCCAGCCGTTTGTCCGCGGCGACAGTGCGCGCACCATTAGCGGCACGGGATTAGGGCTGGCAATTGTGCAGCGTATCGTGGATAACCATAACGGGATGCTGGAGCTTGGCACCAGCGAGCGGGGCGGGCTTTCCATTCGCGCCTGGCTGCCAGTGCCGGTAACGCGGGCGCAGGGCATGACAAAAGAAGGGTAATCTAGAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGCC

  20. Device to System Plasmids and Transformation

  21. Now for the Good Part(2009 Cambridge iGEM Team)

  22. The Problem • Toxins contaminate the environment • Detection can be expensive and complicated • Can cheap bacteria be used as toxin indicators that change color in response to toxin levels?

  23. The Color-Generating Device • Contain violacein pigment devices (ORF from Chromobacterium violacein) Genes re-engineered to produce purple and green in E. Coli • If all 5 genes in the ORF are expressed - purple pigment produced • If third gene in ORF sequence is removed - green pigment produced

  24. The Chassis • To a Synthetic Biologist = Escherichia coli

  25. Bacterial transformation of Escherichia coli • Two different strains of E. coli (4-1 & 4-2) • Two different plasmids (pPRL & pGRN) • Can we expect the devices to behave the same in each strain, or will the chassis have an effect on the intensity of color produced?

  26. Creation of a Bacterial Cell Controlledby a Chemically Synthesized Genome Dan Gibson, +21, Ham Smith and Craig Venter Science (2010) 329: 52 M. mycoides genome transplanted to M. capricolum PCR for watermarks

  27. Creation of a Bacterial Cell Controlledby a Chemically Synthesized Genome Dan Gibson, +21, Ham Smith and Craig Venter Science (2010) 329: 52 Presidential Commission for the Study of Bioethical Issues New Directions: The Ethics of Synthetic Biology and Emerging Technologies December 2010

More Related