1 / 73

DNA Microarrays (Gene Chips) and Cancer

DNA Microarrays (Gene Chips) and Cancer. Cancer Education Project University of Rochester. DNA Microarrays (Gene Chips) and Cancer. http://www.biosci.utexas.edu/graduate/plantbio/images/spot/microarray.jpg. http://www.a ffymetrix.com. RNA. Nucleus. Proteins. DNA. Cell membrane.

riegel
Download Presentation

DNA Microarrays (Gene Chips) and Cancer

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. DNA Microarrays (Gene Chips) and Cancer Cancer Education Project University of Rochester

  2. DNA Microarrays (Gene Chips) and Cancer http://www.biosci.utexas.edu/graduate/plantbio/images/spot/microarray.jpg http://www.affymetrix.com

  3. RNA Nucleus Proteins DNA Cell membrane Part 1 Gene Expression and Cancer

  4. All your cells have the same DNA Sperm Embryo Egg Fertilized Egg - Zygote

  5. DNA in the nucleus Genes How do cells that have the same DNA (genes) end up having different structures and functions?

  6. Different genes are turned on in different cells.DIFFERENTIAL GENE EXPRESSION

  7. GENE EXPRESSION (Genes are “on”) Transcription Translation DNA (Gene) mRNA protein cell structure and function Converts the DNA (gene) code into cell structure and function

  8. Differential Gene Expression Different genes make different mRNA’s Different genes are turned on in different cells

  9. Differential Gene Expression Different mRNA’s make different Proteins Different genes are turned on in different cells Different genes make different mRNA’s

  10. An example of differential gene expression White blood cell Stem Cell Platelet Red blood cell Bone marrow stem cells differentiate into specialized blood cells because different genes are expressed during development.

  11. Normal Differential Gene Expression Genes mRNA mRNA Expression of different genes results in the cell developing into a red blood cell or a white blood cell

  12. Cancer and Differential Gene Expression mRNA Genes But some times….. Mutations can lead to some genes being more or less expressed. CANCER CELL Abnormal gene expression may result in cancer mRNA mRNA

  13. Gene Expression and Cancer Table 1: Predicting Gene Expression in Genes Involved in Cancer

  14. Your Task:Use the information in the second column of the chart to predict whether each gene will be MORE expressed or LESS expressed in cancer cells than in normal cells.

  15. A1An oncogene that produces a protein in an accelerator signal pathway. Growth signal receptor Growth Signal protein Growth or accelerator signal pathway http://biotechinstitute.org/resources/pdf/yw11_1_oh.pdf

  16. A1An oncogene that produces a protein in an accelerator signal pathway. Growth signal receptor Growth Signal protein Growth or accelerator signal pathway MORE Expressed http://biotechinstitute.org/resources/pdf/yw11_1_oh.pdf

  17. A2A tumor suppressor gene that produces a protein in a brake signal pathway http://biotechinstitute.org/resources/pdf/yw11_1_oh.pdf Brake Signal Protein Brake Signal Receptor Brake Signal Pathway

  18. A2 A tumor suppressor gene that produces a protein in a brake signal pathway http://biotechinstitute.org/resources/pdf/yw11_1_oh.pdf Brake Signal Protein Brake Signal Receptor Brake Signal Pathway LESS Expressed

  19. A3A guardian gene that produces p53 protein that inspects for DNA damage and triggers apoptosis if DNA damage cannot be repaired http://biotechinstitute.org/resources/pdf/yw11_1_oh.pdf Proteins that trigger apoptosis p53 protein checks for DNA damage

  20. A3A guardian gene that produces p53 protein that inspects for DNA damage and triggers apoptosis if DNA damage cannot be repaired http://biotechinstitute.org/resources/pdf/yw11_1_oh.pdf Proteins that trigger apoptosis p53 protein checks for DNA damage LESS Expressed

  21. A4A gene that produces DNA repair enzymes that correct mutations DNA Repair Enzyme http://biotechinstitute.org/resources/pdf/yw11_1_oh.pdf

  22. A4A gene that produces DNA repair enzymes that correct mutations DNA Repair Enzyme LESS Expressed http://biotechinstitute.org/resources/pdf/yw11_1_oh.pdf

  23. Work individually Complete Table 1

  24. Part 2 DNA Microarray Technology Gene expression in colon cancer cells

  25. Colon Cancer: Normal colon cells The colon (large intestine) is lined with cells that absorb water and secrete mucous. Cancerous colon cells

  26. Colon Cancer:Uncontrolled Cell Division Cancerous Colon Cells Cancer cells divide rapidly to form a tumor

  27. Expression of cancer causing genes Cancer causing gene If some genes that should be off are actually ON (expressed), they can cause the cell to show cancerous traits Cancer causing protein

  28. Expression of cancer preventing genes Expression of cancer preventing genes can block cancer causing proteins. This is an example of a mechanism for maintaining homeostasis Cancer preventing gene Cancer preventing protein

  29. However, if cancer preventing genes are turned OFF (not expressed), then the cell can become cancerous OFF ON

  30. CANCEROUS CELLS OFF ON Cancer causing genes are ON (expressed) Cancer preventing genes are OFF (not expressed)

  31. Changes in gene expression may lead to uncontrolled cell division Normal Cell Cancer Cell Genes mRNA Genes mRNA

  32. Changes in gene expression may lead to uncontrolled cell division Normal Cell Cancer Cell Genes mRNA Genes mRNA

  33. Normal Cell Cancer Cell Is the blue gene a cancer causing or cancer preventing gene?

  34. Normal Cell Cancer Cell Cancer Preventing Is the pink gene a cancer causing or cancer preventing gene?

  35. Normal Cell Cancer Cell Cancer Preventing Cancer Preventing Is the brown gene a cancer causing or cancer preventing gene?

  36. Normal Cell Cancer Cell Cancer Preventing Cancer Preventing Not involved Is turquoise gene a cancer causing or cancer preventing gene?

  37. Normal Cell Cancer Cell Cancer Preventing Cancer Preventing Not involved Cancer Causing Studying changes in gene expression may lead to ways to prevent, diagnose, or treat cancer

  38. We can use DNA microarray technology to study changes in gene expression that lead to cancer • http://www.affymetrix.com/corporate/media/image_library/low_res/xenopus_array.jpg

  39. What is a DNA microarray? A DNA microarray is a plastic chip or glass slide that has been “printed” with thousands of short, single-stranded pieces of DNA for known genes. • http://www.affymetrix.com/corporate/media/image_library/low_res/xenopus_array.jpg

  40. What is a DNA Microarray? • Glass or plastic slide • Each spot on the slide has different DNA sequences • Microarrays usually have thousands of DNA spots 4 1 2 3 A B C aaattcgatagca aaattcgatagca aaattcgatagca aaattcgatagca aaattcgatagca

  41. aaattcgatagca aaattcgatagca • Microscopic spot of single stranded DNA sequences attached to a slide. aaattcgatagca aaattcgatagca aaattcgatagca http://www.affymetrix.com

  42. Microarrays can be used to determine the types and quantities of mRNAs transcribed. Transcription Translation DNA (Gene) mRNA protein

  43. How does a DNA Microarray work? Labeled RNA or DNA in a sample Binds to DNA on chip http://www.affymetrix.com

  44. A Class Model of a Microarray Studying gene expression in colon cancer cells

  45. Summary Sheet Follow the steps on the summary sheet as the class models the steps in a microarray experiment

  46. STEP 1 • “Print” genes that might be involved in causing colon cancer onto the chip. • Also “print” positive and negative control genes. 4 1 2 3 A B C aaattcgatagcagtagactcgaggg aaattcgatagcagtagactcgaggg aaattcgatagcagtagactcgaggg aaattcgatagcagtagactcgaggg aaattcgatagcagtagactcgaggg

  47. STEP 1 • A “wall-mounted” microarray has been pre-printed with genes that we will study. 4 1 2 3 A B C

  48. STEP 2 • Collect cancerous colon cells and normal colon cells from a patient. Normal Colon Cells Cancerous Colon Cells

  49. STEP 2 • One side of the class will use an envelope representing cancerous colon cells • The other side of the class will use an envelope representing normal colon cells

  50. STEP 3 • Isolate mRNA from the two types of cells Detergents Proteases DNAases Remember, when a gene is expressed, the DNA is transcribed (copied) to make messenger RNA (mRNA) Pieces of DNA, proteins, membranes mRNA

More Related