1 / 42

Precomputing Edit-Distance Specificity of Short Oligonucleotides

Precomputing Edit-Distance Specificity of Short Oligonucleotides. Nathan Edwards Center for Bioinformatics and Computational Biology University of Maryland, College Park. Polymerase Chain Reaction. Polymerase Chain Reaction. Primer Specificity.

roanna-clark
Download Presentation

Precomputing Edit-Distance Specificity of Short Oligonucleotides

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Precomputing Edit-Distance Specificity of Short Oligonucleotides Nathan Edwards Center for Bioinformatics and Computational Biology University of Maryland, College Park

  2. Polymerase Chain Reaction

  3. Polymerase Chain Reaction

  4. Primer Specificity • Need to ensure that primers hybridize to a specific (specified) locus only • Require exactly one occurrence of specified sequence • Require no (potential) mis-hybridization loci • Bottleneck computation in primer-design • Design / check iteration is problematic

  5. k-unique 20-mers • Edit-distance as a surrogate for mis-hybridization potential • k-unique loci: • All non-self genomic loci are require more than k edits in (global) alignment • Closest non-self genomic loci requires (k+1) edits in (global) alignment

  6. Find all k-unique 20-mers • Naïve algorithm: O(n2km) • Quadratic in size of genome. • 0-unique (exact match) 20-mers • (Expected) linear time algorithm • Achieve expected linear time using a hybrid approach (blastn): • Use partial exact match to “seed” expensive dynamic programming alignment • Large chunks ) Fast, but miss occurrences • Small chunks ) Slow, but correct

  7. Inexact sequence match Baeza-Yates Perleberg: • Correct and O(n) for small k • At least 1 chunk is observed with no error. • Small k → Large chunks → Fast and correct • Largest correct chunk: floor(m/(k+1)) g ≠ = ≠ q

  8. Example worst case alignments TCCCGC-TAGATTGAGATCT ||||||v||||||*|||||| TCCCGCCTAGATTTAGATCT ACTTGTCCACAGTGCTTAAG ||||||*||||||*|||||| ACTTGTGCACAGTCCTTAAG

  9. AA:18 AC:1,9 AG:11,19 CA:8,10 CC:14 CT:2,15 GC:7 GT:5,12 TA:17 TC:13 TG:4,6 TT:3,16 Brute-force approach ACTTGTGCACAGTCCTTAAG 2-mer position table

  10. Brute-force approach ACTTGTGCACAGTCCTTAAG ACTTGTGCACAGTCCTTAAG

  11. Brute-force approach ACTTGTGCACAGTCCTTAAG ACTTGTGCACAGTCCTTAAG

  12. Brute-force approach ACTTGTGCACAGTCCTTAAG ACTTGTGCACAGTCCTTAAG

  13. Brute-force approach ACTTGTGCACAGTCCTTAAG ACTTGTGCACAGTCCTTAAG

  14. Brute-force approach ACTTGTGCACAGTCCTTAAG ACTTGTGCACAGTCCTTAAG

  15. Brute-force approach ACTTGTGCACAGTCCTTAAG ACTTGTGCACAGTCCTTAAG

  16. Brute-force approach Divide the genome into 10 Mb blocks For all pairs of blocks: For all l-mer matches: Do all pair-wise DPs containing match If ≤ k edits, mark position non-unique 300 x 300 pairs of blocks For 20-mers: k=1 )l=10; k=2 )l=6; k=3 )l=5 ; k=4 )l=4.

  17. Brute-force approach Things are looking really, really, bad: • Seeds are too short • 90,000 pair-wise block comparisons Actually quite good (seed size 12): • Non-uniqueness certificates are dense • Almost all positions eliminated early • Behaves more like linear time than quadratic

  18. In practice (edit-dist 4)

  19. In practice (edit-dist 4)

  20. In practice (edit-dist 4)

  21. In practice (edit-dist 3)

  22. In practice (edit-dist 3)

  23. In practice (edit-dist 4,3,2)

  24. In practice (edit-dist 4,3,2)

  25. Edit distance 2 • After seed size 12 • ~ 27K (0.288%) positions have no match • After seed size 8 • ~ 3K (0.029%) positions have no match • Using seed size 6 is still too slow • Need a more sophisticated hashing strategy • 6-mers match in too many places!

  26. Spaced seed-set design problem • Given: • mer-size: m ( = 20 ) • # errors: k ( = 1,2,3) • # cares: l ( = 10,12,14 ) • Find the smallest set of spaced seeds that will find all alignments.

  27. Solution for (20,2,8) • 11111111, 111101111 TCCCGCGTAGATTGAGATCT ||||||*||||||*|||||| TCCCGCCTAGATTTAGATCT • How can we find these spaced seed set solutions? • One/two table? 2 x false positives

  28. Spaced seed set design set-cover formulation • Set cover instance: • Ground set: all possible placements of the k errors (alignments) • Covering sets: all possible placements of the l care positions • For (m=20,k=2,l=10), • 190 elements, 184,756 sets! • Need to reduce the number of sets!

  29. Dirty secret of spaced seeds • Spaced seeds take O(# cares) to update! • Contiguous seeds are O(1) to update • 101010101010101 vs 11111111 • 8 steps to update vs 1 step to update • Constant time update for spaced seeds? • Yes, if they have a certain structure(s) • Restrict spaced seeds to small update cost

  30. O(1) spaced seed update ACGTACGTACGTACGTACGT 1: A G A G 2: C T C T ... Spaced seed 1010101 can be updated in 1 step!

  31. O(1) spaced seed update ACGTACGTACGTACGTACGT ACGTACG -> ACGACG CGTACGT -> CGTCGT ... Spaced seed 1110111 can be updated in 1 step!

  32. O(1) spaced seed update • “Period” step update • 11001100110011 2 steps • 1000010000100001 1 step • “Runs” step update • 11100111111 1 step • 11101110111 2 steps • Minimize the number of update steps • Weighted set-cover instance…

  33. Edit-distance SS-SDP • Position of matching bases might shift! • Need 11111111 ↓ to get CCGCTAGA • Need 111101111 ↑ to get CCGCTAGA • Set cover formulation no longer works TCCCGC-TAGATTGAGATCT ||||||v||||||*|||||| TCCCGCCTAGATTTAGATCT

  34. Edit-Distance SS-SDP • Use a variation on set cover: • q:111101111,r:11111111 covers: • Pay for query & reference update costs separately • Control size of problem by only enumerating templates with small update cost r:TCCCGC-TAGATTGAGATCT ||||||v||||||*|||||| q:TCCCGCCTAGATTTAGATCT

  35. Correct solutions for 1-unique 20-mers 107 random sequence x 107 random sequence • Seed: 1111111111 (Best single seed solution, weight 10) • ~ 9.5 expensive dynamic programs per locus • Seed set: 11111111111;111110111111 (weight 11) • ~ 8.9 DP/locus • Seed set (weight 11) • ~ 7.8 DP/locus • Seed set: 111111111111;1111101111111 (weight 12) • ~ 2.2 DP/locus 11111111111 ~ 111101111111111101111111 ~ 11111111111 111101111111 ~ 111101111111

  36. Correct solutions for 1-unique 20-mers 107 random sequence x 107 random sequence • Seed set: 111111111111;1111101111111 (weight 12) • ~ 2.5 DP/locus • Seed set (weight 12) • ~ 1.8 DP/locus • Seed set: 1111111111111;11111101111111 (weight 13) • ~ 0.56 DP/locus (same specificity as contiguous seed weight 12) • Seed set (weight 14) • ~ 0.20 1111110111111 x 111111111111 1111110111111 111111001111111 11111111111111 ~ 11111111111111 111110111111111 ~ 11111111111111 111111111110111 ~ 11111111111111 111111111110111 ~ 111111111110111 11111111111111 ~ 111111101111111111110111111111 ~ 111110111111111

  37. Correct solutions for 2-unique 20-mers • Seed: 111111 (Best single seed solution, weight 6) • ~ 2439 DP/locus • Weight 10 – 73 DP/locus (specificity of 8/9 contig seed) • Weight 12 – 10 DP/locus (specificity of 10 contig seed) 1111111111 ~ 1111111111 11111011111 ~ 1111111111 11111011111 ~ 11111011111 1111100000011111 ~ 1111100000011111 11111000000011111 ~ 1111100000011111 111110000000011111 ~ 1111100000011111 111110000011111 ~ 1111100000011111 111110000000011111 ~ 11111000000000011111

  38. k-unique human 20-mers • No 4-unique 20-mers • No 3-unique 20-mers • 0. 038% of (forward) human 20-mers are 2-unique • 1088322 in total • about 1 every 2638 bases • Fast 2-uniquness oracle

  39. Genome Browser Track Edit Distance: • UCSC Track: 1-unique 20-mers • UCSC Track: 2-unique 20-mers

  40. Integration with High Performance Computing • Break sequence into chunks of size 107. • Remember which positions have been eliminated. • Integrated with (UMIACS) Condor • Too unreliable for very large sequences • NFS filesystem is unreliable • Simultaneous jobs capped at ~ 300 • Integrated with hadoop/map-reduce on 80 nodes (Edwards Lab) • Reliability improved, DFS solves (some) filesystem woes • Much better scalability (in theory, yet to be tested) • Explicit synchronization of reduce step is undesirable.

  41. Other improvements • Other groupings are possible: • Species designation on FASTA defline can be any suitable partition • Constraints on the position of edits: • False positive due to mishybridization at 3’ end is unlikely to be observed with some technologies • Constraint on valid Tm range: • Computed as in Primer3 • Can eliminate undesirable mers early

  42. Conclusions • Precompute of human k-unique 20-mers is now feasible! • Faster for large edit-distance! • Need spaced seed-set designs • Constant time update for spaced seeds • Good integer programming formulation of SS-SDP • Limited template enumeration based on update cost • Work with integer programming experts to solve effectively

More Related