1 / 25

GENETIC IDENTIFICATION OF FISH EGGS IN FORMALDEHYDE-FIXED PLANKTON SAMPLES MARINEGGS

GENETIC IDENTIFICATION OF FISH EGGS IN FORMALDEHYDE-FIXED PLANKTON SAMPLES MARINEGGS. 5FP- Reference QLK5-CT1999-01157. Garcia-Vazquez E. 1 , Perez J. 1 , Martinez J. L. 1 , Alvarez P. 2 , Lopes P. 3 , Gomes L. 3 , Teia A. 3 , Karaiskou N. 4 , Triantafyllidis A. 4 and Triantaphyllidis C. 4.

rosalyn-yanez
Download Presentation

GENETIC IDENTIFICATION OF FISH EGGS IN FORMALDEHYDE-FIXED PLANKTON SAMPLES MARINEGGS

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. GENETIC IDENTIFICATION OF FISH EGGS IN FORMALDEHYDE-FIXED PLANKTON SAMPLES MARINEGGS 5FP- Reference QLK5-CT1999-01157

  2. Garcia-Vazquez E.1, Perez J.1, Martinez J. L.1, Alvarez P.2, Lopes P.3, Gomes L.3, Teia A.3, Karaiskou N.4, Triantafyllidis A.4 and Triantaphyllidis C.4 1 University of Oviedo, Spain 2 AZTI, Basque Country, Spain 3 IPIMAR, Portugal 4 Aristotle University of Thessaloniki, Greece

  3. The problem * Spawning of commercially important fish species overlap in time and space * Stock biomass estimation is likely biased by ambiguous identification of eggs and larvae

  4. Mackerel eggs

  5. Hake eggs

  6. Atlantic hake Merluccius merluccius Atlantic horse-mackerel Trachurus trachurus Megrim Lepidorhombus whiffiagonis Mackerel Scomber scomber Sardine Sardina pilchardus Four spotted megrim Lepidorhombus boscii Spanish mackerel Scomber japonicus Whiting Merlangius merlangus Snipe fish Macrorhamphosus scolopax Nine species of commercial interest

  7. Handling formaldehyde-fixed eggs • Protocol A • Rinse eggs in PBS twice • Put individual eggs in a filter paper. Squash with another paper • Cut the paper around the egg and put it in an Eppendorf • Follow to Chelex or to Qiagen (QIAamp DNA Mini Kit) • Protocol B • wash individual eggs in PBS for 2-3 min • squash the egg with a pipette tip

  8. DNA extraction protocols for egg samples • Proteinase K and phenol/chlorophorm (Taggart et al. 1992) • 2 x CTAB/proteinase K • Resine extraction (12% Chelex) • Bilatest DNA kit • QIAmp mini Kit

  9. Our Chelex protocol • Embed the egg in 150 μl of 12% Chelex + 20 μl proteinase K at 55ºC for at least 1 h • Inactivate proteinase K at 100ºC for 20 min

  10. Comparing DNA extraction protocols (formaldehyde-fixed eggs)

  11. The marker A sequence within the 16S rDNA gene, amplified with the primers: • 16S-A: 5’-TGTCTTCGGTTGGGGCGA-3’ • 16S-B: 5’-GCTGTTATCCCTGGGGTAAC-3’

  12. Methods • PCR amplification (conditions detailed in Perez et al. 2005) • Fluorescent fragment detection: by capillary electrophoresis in a 3100 Genetic Analyzer (Applied Biosystems) with a 36 cm capillary and POP 4 polymer • Fragment sizes established using the GeneScan 3.7 Analysis Software (Applied Biosystems)

  13. Merluccius merluccius: 155 bp (154-156)Lepidorhombus whiffiagonis: 168 bp (167-170)Lepidorhombus boscii: 171 bp (171-174)

  14. Fragment sizes obtained for partial 16S rRNA sequence in different species employing the primers 16S-A and 16S-B • Species Fragments (bp) • Trachurus trachurus 178 (+ 163-164) • Macrorhamphosus scolopax 156 • Scomber scomber 160-164 (+ 148-150) • Scomber japonicus 160-164 (+ 148-150) • Sardina pilchardus 156 + 142 • Merlangius merlangus 157-158 • Merluccius merluccius 155 • Lepidorhombus whiffiagonis 168 • Lepidorhombus boscii 171

  15. Additional markers for Scomber spp. • SST F 5’ – TGTCATCACTAACCTACTCTCA – 3’ • SST R 5’ – GGTGGAGAACCGCTGCCGCTAA – 3’ • SJT F 5’ – ATTCGTTATCCTGGCAGCAACAA – 3’ • SJT R 5’ – TGCGAGAGAGGAGAGGGCCACG – 3’ SST F & R, S. scomber; SJT F & R, S. japonicus

  16. Another technique for egg identification SSCP patterns obtained at the complete 16S rRNA genes for different fish species 1: Macrorhamphosus scolopax 2: Scomber scomber 3: Trachurus trachurus 4: Lepidorhombus boscii 5: L. whiffiagonis 6: Merluccius merluccius 7: Merlangius merlangus 8: Molva molva 9: Pollachius virens 10: Pollachius pollachius 11: Gadus morhua 12: formaldehyde-fixed egg (Trachurus trachurus)

  17. SSCP technique works in formaldehyde-fixed eggs PCR-SSCP patterns found for Lepidorhombus whiffiagonis eggs fixed in ethanol (6-12) or in 4% formaldehyde (13-19). Control adults: 1-2, Lepidorhombus whiffiagonis; 3-5, Merluccius merluccius

  18. Identification of 69 test eggs (Bay of Biscay) First marker: partial 16S rDNA gene, primers 16S-A & 16S-B

  19. We have the markers Do we really need genetic markers for egg identification?

  20. Hake eggs

  21. Overlapped spawning areas for M. merluccius, L. boscii and L. whiffiagonis

  22. Visual vs genetic identification of hake/megrim eggs

  23. Future perspectives • Project FISH & CHIPS (6FP) Towards DNA chip technology as a standard analytical tool for the identification of marine organisms • Cordis: Technology Marketplace (http://www.cordis.lu/marketplace/home.html; Offer in Biology/Medicine “Species-specific fish assessment” )

  24. Acknowledgments • Ivan G. Pola (University of Oviedo) helped in laboratory tasks

  25. Thanks for your attention

More Related