1 / 26

A novel efficient HBV vaccine candidate based on HBc and preS1 components presented by VLPs

This symposium presentation discusses the development of a novel therapeutic HBV vaccine candidate based on HBc and preS1 components presented by virus-like particles (VLPs). The vaccine aims to address the limited effectiveness of existing HBV vaccines and target non-responders, chronically infected individuals, and HBV cancer patients.

rworthley
Download Presentation

A novel efficient HBV vaccine candidate based on HBc and preS1 components presented by VLPs

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. A novel efficient HBV vaccine candidate based on HBc and preS1 components presented by VLPs Andris Dišlers 24.05.2016 Symposium: TARGETS OF IMMUNOTHERAPY OF CHRONIC VIRAL INFECTIONS AND CANCER Rīga Stradiņš University, Dzirciema iela 16, Rīga, Latvia Senate Hall, Block K

  2. therapeutic vaccine is still needed “Although considerable information about the life cycle, epidemiology, immunology, pathogenesis and prevention of HBV has been available during the last three decades, there has been no significant progress in treating patients with chronic hepatitis B (CHB)”, Akbar, 2013.

  3. existing HBV vaccine is based on small HBs • characteristics of an existing HBs-based vaccines: • low immunogenicity for elderly people, for • not for chronically infected, no CTL inducing activity

  4. HBc-preS1 VLPs: the way to make the universal HBV vaccine • contribution of HBc: CTL epitope rich • contribution ofpreS1: B-cell response, enhanced within VLP carrier • possible application of HBc-preS1 particles: • - for non-responders • - for chronically infected • - for HBV cancer patients

  5. VLPs – why? • highly immunogenic, resembling that of viruses • a carrier of epitopes to be attached on the surface chemically or genetically to make chimeric particles • biotechnological advatages – in many cases stability in production and comfortable for purification

  6. technology of HBc-preS1 VLPs • preS1 can be inserted in different sites of HBc as a molecule: • in the MIR, the central immunodominant part of HBc when the preS1 is exposed on the tips of spikes formed by HBc dimers • 2. at the C-end of HBc as extension of HBc protein – not disturbing VLP formation • 3. at the N-end of HBcmolecule – typically interacts with VLP formation and lowers the yield of VLPs

  7. Construction of chimeric HBc-preS1 VLPs variants: insertion at MIR, at N-terminus and at C-end preS1 preS1 preS1

  8. preS1 fragments for insertion preS1(20-47) hNPLGFFPDHQLDPAFRANTANPDWDFNPvd preS1Δ(12-60/89-119) QMGQNLSTSNPLGFFPDHQLDPAFRANTANPDWDFNPNKDTWPDANKVGAPANPPPASTNRQSGRGPTPLSPPLRNTHPQAd DPAFR – the minimal virus-neutralizing epitope

  9. structure of preS1-insert preS1Δ(12-60/89-119): Hydrophobic region 61-88 is framed, it has been cut out from the sequence of the preS1 insert

  10. HBc-preS1 VLP production HBc-expression vector: pBR327 based, with two selective markers (Ap and Km)

  11. expression of HBc-preS1in E.coli • flask-cultivation, Trp-rich medium, limited aeration • Arg-codons of the C-end are E.coli-optimized starting from position 150 of HBc protein with mostly cgt used for Arg cgtcgtcgtggccgttcccctcgtcgtcgtactccctcggccgtcgtcgttctcaatcgccgcgtcgccgtcgttctcaatctcgtgaatctcaatgttagtaa

  12. insertion at MIR – the more popular site for the insertions 1 7583 144 183 HBc MIR polyArg not exposed

  13. X-ray structure of HBc tips of spikes: the major immunodominant region (MIR)

  14. chimeric HBc dimer (chains A and B): MIR: insertion after the position 78 modelling by 3D-JIGSAW

  15. structure of HBc, chains A and

  16. VLPs of HBc-preS1 HBc183 with preS1 (20-47, A) and preS1delta (B) inserts at the MIR of HBc

  17. C-end aa modifications of HBc full exchange of Arg at the C-end of HBc: GGGGGSPGGGTPSPGGGGSQSPGGGGSQSGESQC** or Gly starting from position 152 or 159 1 144 183 HBc Arg exchanged insertion exposed !

  18. C-end aa modifications of HBc • addition of extra, Gly-containing tail to normal HBc: HBc(183)-GGGGGSPGGGTPSPGGGGSQSPGGGGSQSGESQC ↓ use for C-terminal insertions of preS1(20-47) and preS1delta at the C-end of “two-tail” construct

  19. anti-HBc and anti-preS1 response in mice immunized with HBc-preS1(20-47) and HBc-preS1delta : different HBc vectors, MIR and C-terminal insertions HBc vectors:183, 178, 171, 167, 163183+Gly, 152+Gly and 159+Gly characterization

  20. HBV genotypes used for HBc VLPs • genotype D: HBc 1-183 aa • genotype G: HBc 1-195 aa (extra 12 aa at the N-end) • ↓ • use of G genotype for insertion of preS1 • at the N-end of HBc

  21. advantages of HBc VLPs of HBV genotype G • high and stable VLP yield in E.coli • high dimer yield at the dissociation and VLP recovery • after reassociation • ↓ • use of dissociation-reassociation to purify VLPs from • incorporated material (RNA) and fill-up VLPs with • characterized material (packaging)

  22. specific problems with VLPs • incorporation of unspecific nucleic acids from the host cells • presence of E.coli endotoxins in VLP preparations • ↓ • for removal of unspecific RNA: • use of dissociation-reassociation • 2. use of alternative method to destroy the unspecific RNA – hydrolisis at pH >12

  23. G genotype HBc expression and purification

  24. G genotype dissociation to dimers

  25. G genotype packaging of Larifan (Riga), dsRNA from RNA-phage

  26. Thank You!

More Related