AP Details for Protein Synthesis

1. AP Details for Protein Synthesis 2013

2. From gene to protein Transcription Translation

3. Transcription fromDNA nucleic acid languagetoRNA nucleic acid language

4. Transcription • Making mRNA • transcribed DNA strand = template strand • untranscribed DNA strand = coding strand • same sequence as RNA • synthesis of complementary RNA strand • transcription bubble • Enzyme involved • RNA polymerase coding strand 3 A G C A T C G T 5 A G A A A C G T T T T C A T C G A C T DNA 3 C T G A A 5 T G G C A U C G U T C unwinding 3 G T A G C A rewinding mRNA template strand RNA polymerase 5 build RNA 53

5. RNA polymerases • 3 RNA polymerase enzymes • RNA polymerase 1 • only transcribes rRNA genes • makes ribosomes • RNA polymerase 2 • transcribes genes into mRNA • RNA polymerase 3 • only transcribes tRNA genes • each has a specific promoter sequence it recognizes

6. Which gene is read? • Promoter region • binding site before beginning of gene • TATA box binding site • binding site for RNA polymerase & transcription factors • Enhancer region • binding site for activators (activate genes) • Silence region • Binding site for repressors (turns genes off)

7. What are Transcription Factors? • Initiation complex • transcription factors bind to promoter region • suite of proteins which bind to DNA • turn on or off transcription • trigger the binding of RNA polymerase to DNA

8. RNA polymerase Matching bases of DNA & RNA A C U • Match RNA bases to DNA bases on one of the DNA strands G A G G U C U U G C A C A U A G A C U A 5' 3' G C C A T G G T A C A G C T A G T C A T C G T A C C G T

9. intron = noncoding (inbetween) sequence exon = coding (expressed) sequence Eukaryotic genes have junk! • Eukaryotic genes are not continuous • exons = the real gene • expressed / coding DNA • introns = the junk • inbetween sequence intronscome out! eukaryotic DNA

10. intron = noncoding (inbetween) sequence exon = coding (expressed) sequence mRNA splicing • Post-transcriptional processing • eukaryotic mRNA needs work after transcription • primary transcript = pre-mRNA • mRNA splicing • edit out introns • make mature mRNA transcript ~10,000 bases eukaryotic DNA pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA

11. Splicing must be accurate • No room for mistakes! • a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP|

12. snRNPs snRNA intron exon exon 5' 3' spliceosome 5' 3' lariat 5' 3' exon exon mature mRNA excised intron 5' 3' RNA splicing enzymes • snRNPs • small nuclear RNA • Spliceosome • several snRNPs • recognize splice site sequence • cut & paste gene No, not smurfs! “snurps”

13. 3' poly-A tail 3' A A A A A mRNA 50-250 A’s 5' cap P P P 5' G More post-transcriptional processing • Need to protect mRNA on its trip from nucleus to cytoplasm • enzymes in cytoplasm attack mRNA • protect the ends of the molecule • add 5 GTP cap • Chemically modified molecule of GTP • It facilitates the binding of mRNA to the ribosome and protects the mRNA from being digested by ribonucleases – enzymes in cytoplasm that break down RNA • add 3’poly-A tail • longer tail – 100-300 adenine nucleotides • Assists in export of mRNA from nucleus • Important in mRNA stability

14. Translation fromnucleic acid languagetoamino acid language

15. The code • Code for ALL life! • strongest support for a common origin for all life • Code is redundant • several codons for each amino acid • 3rd base “wobble” • Start codon • AUG • methionine • Stop codons • UGA, UAA, UAG

16. Transfer RNA structure • “Clover leaf” structure • anticodon on “clover leaf” end • amino acid attached on 3 end

17. Loading tRNA • Aminoacyl tRNA synthetase • enzyme which bonds amino acid to tRNA • bond requires energy • ATP  AMP • bond is unstable • so it can release amino acid at ribosome easily Trp C=O Trp Trp C=O H2O OH O OH C=O O activating enzyme tRNATrp A C C mRNA U G G anticodon tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA

18. 3 2 1 Building a polypeptide • Initiation • brings together mRNA, ribosome subunits, initiator tRNA • Elongation • adding amino acids based on codon sequence • Termination • end codon release factor Leu Val Ser Met Met Ala Leu Met Met Leu Leu Trp tRNA C A G C G A C C C A A G A G C U A C C A U A U U A U G A A 5' 5' A A 5' C U U 5' A A G G A G U U G U C U U U G C A C U 3' G G U A A U A A C C mRNA 3' 3' 3' U G G U A A 3' E P A

19. Protein targeting • Destinations: • secretion • nucleus • mitochondria • chloroplasts • cell membrane • cytoplasm • etc… • Signal peptide • address label

20. RNA polymerase DNA Can you tell the story? aminoacids exon intron tRNA pre-mRNA 5' GTP cap mature mRNA aminoacyl tRNAsynthetase poly-A tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome

21. Bacterial chromosome Protein Synthesis in Prokaryotes Transcription mRNA Psssst…no nucleus! Cell membrane Cell wall

22. Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons intron = noncoding (inbetween) sequence exon = coding (expressed) sequence Prokaryote vs. Eukaryote genes intronscome out! eukaryotic DNA

23. Translation in Prokaryotes • Transcription & translation are simultaneous in bacteria • DNA is in cytoplasm • no mRNA editing • ribosomesread mRNA as it is being transcribed

24. Translation: prokaryotes vs. eukaryotes • Differences between prokaryotes & eukaryotes • time & physical separation between processes • takes eukaryote ~1 hour from DNA to protein • no RNA processing

25. Any Questions?? What color would a smurf turnif he held his breath?