1 / 57

Novel Methods for the Detection of Nucleic Acid Sequences

Novel Methods for the Detection of Nucleic Acid Sequences. Katrina Battle Literature Presentation March 22, 2010. Objective. Provide a comparison of alternative methods for the detection of hybridized DNA sequences. Introduction a) DNA and importance of detection b) Raman Spectroscopy

saxton
Download Presentation

Novel Methods for the Detection of Nucleic Acid Sequences

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010

  2. Objective Provide a comparison of alternative methods for the detection of hybridized DNA sequences

  3. Introduction a) DNA and importance of detection b) Raman Spectroscopy c) the Quantum Dot d) Comparison of Fluorophores to Quantum Dots Detection Approaches a) Use of Quantum dots (QDs) b) Use of Surface-Enhanced Resonance Raman Spectroscopy (SERRS) Comparison of methods Critiques Acknowledgements Questions

  4. Deoxyribonucleic Acid (DNA) • Oligonucleotides are short nucleic acid polymers, typically with twenty or fewer bases • Readily bind to their respective complementary nucleotide • r respective complementary nucleotide www.bio.miami.edu/.../gene/c16x6base-pairs.jpg http://writersforensicsblog.wordpress.com/2009/11/ Library.thunkquest.org/18617/data/types/dna.html

  5. Importance of Detection Gene detection Potential biomarkers Screening for various infections Diagnosis and treatment www.pharmaceutical-int.com/images/companies/8 www.hemorrhoidinformationcenter.com/wp-conten www.sciencedaily.com/.../05/050513102615.jpg www.medicues.com/.../bacteriasalmonella-copy.jpg

  6. Raman Spectroscopy Lowest excited electronic state 3 2 1 0 Rayleigh scattering E = hνex Raman scattering E = hνex ± ΔE E = hνex Virtual states ΔE E = hνex Stokes, E = hνex - ΔE anti-Stokes, E = hνex + ΔE 3 Ground electronic states 2 1 ΔE 0

  7. Resonance Raman Spectroscopy • Excited electron immediately relaxes into a vibrational level of the ground electronic state, giving up a Stokes photon, νs • Excitation with wavelengths that closely approach that of the electronic absorption band of an analyte • Increased selectivity • Tunable laser required νex νex νs νfl Δνr Resonance Raman Fluorescence

  8. Quantum Dots (QDs) • Semiconductor nanocrystals whose excitons are confined in all three spatial dimensions. • Nanometer-scale atom clusters comprising a core, shell, and coating. • Characteristics are closely related to the size and shape of the individual crystal. • Possess great tunability • Give narrow emission profile www.invitrogen.com

  9. Tunability of Quantum Dots • Possible to have very precise control over the conductive properties of the material • Available with a choice of surface reactivities • Can be made biocompatible and can be functionalized for binding specificity (i.e. avidin/biotin) ΓCdSe core (Å) λmax em. (nm) Medintz, I. et al., Nature Materials, 2005, 4, 435-446

  10. Absorption and Emission Profiles Medintz, I. et al., Nature Materials, 2005, 4, 435-446

  11. Sapsford, K. et al., Sensors, 2006, 6, 925-953

  12. Specific Nucleic Acid Detection Using Photophysical Properties of Quantum Dot Probes Sun Hee Lim, Philippe Buchy, Sek Mardy, Moon Sik Kang, and Alexey Dan Chin Yu Anal. Chem. 2010, 82, 886-891

  13. Goal Introduce an approach for single-step labeling and separation free target detection with only quantum dot (QD) probes using a custom-made portable system and report this application to avian influenza virus A (H5N1). Investigate the affect of oligonucleotide density and length on the lifetime and quenching-based hybridization detection.

  14. Avian Influenza • Influenza virus that occurs naturally among birds. Wild birds worldwide carry the viruses in their intestines • Most cases of avian influenza infection in humans have resulted from contact with infected poultry (e.g., domesticated chicken, ducks, and turkeys) or surfaces contaminated with secretions/excretions from infected birds. www.ciriscience.org/thumbimage.php?id=85 http://www.ehow.com/way_5697386_herbal-cure-bird-flu.html http://www.cdc.gov/flu/avian/gen-info/facts.htm

  15. DNA Sequences Probe Sequences 5’ AGTGCTAGGGAACTCGCC 3’ 18-mer Complementary Target Sequences 25-mer 5’ AGTGCTAGGGAACTCGCCACTGTAG 3’ 18-mer 5’ CGGGAGTTCCCTAGCACT 3’ 25-mer 5’ CTACAGTGGCGAGTTCCCTAGCAC 3’ Noncomplementary Sequences 18-mer 5’ GTAATACGACTCACTATA 3’ 25-mer 5’ GTAATACGACTCACTATAGGGCGAA 3’

  16. Experimental

  17. Preparation of QD Probes COOH COOH COOH COOH COOH COOH COOH COOH COOH COOH COOH COOH COOH COOH COO COOH COOH COOH COOH COOH COOH COOH C COOH R= C18 Spacer Oligonucleotide

  18. Hybridization of QD Probes and Target DNA Lim, S. et. al., Anal. Chem., 2010, 82, 886-891

  19. Portable Detection Device Detector Pulse Generator Filter Lens 2 Sample Holder Blue LED Lens 1 Lim, S. et. al., Anal. Chem., 2010, 82, 886-891

  20. Dye Intercalation • Involves the insertion of a planar fused aromatic ring system between DNA base pairs, leading to significant π-electron overlap • This mode of binding is stabilized by stacking interactions and is thus less sensitive to ionic strength relative to other binding modes PicoGreen www.photobiology.com/.../pierard/intintercal.jpg http://commons.wikimedia.org/.../DNA_intercalation.jpeg http://commons.wikimedia.org/wiki/File:PicoGreen_(topological_formula).png

  21. Verification of Hybridization • 1 µL of 25-mer target DNA was hybridized with 3 µL of 0.15 nM OD probes in PBS buffer (total volume 50 µL) • Shaken at 1000 rpm for 3 hrs. at 25 ° C • Stained with PicoGreen • Calibration curve obtained for quantitative analysis • Calculated hybridization efficiency Target Sequence Probe Sequence Lim, S. et. al., Anal. Chem., 2010, 82, 886-891

  22. Results

  23. QD Probe Conjugation Analysis Lim, S. et. al., Anal. Chem., 2010, 82, 886-891

  24. QD Probe and Target DNA Hybridization Analysis Lim, S. et. al, Anal. Chem. 2010, 82, 886-891

  25. Determination of Hybridization Time • Performed verification of QD probe and hybridized DNA by using microfiltration to remove unhybridized DNA • Shows an increase in hybridization of the 25-mer target DNA and 25-mer QD probes • Hybridization efficiency changed very slightly 0.45 nm QD 3 µM target DNA Lim, S. et. al., Anal. Chem., 2010, 82, 886-891

  26. Quantitative Analysis of QD Probe and Target DNA Hybridization • Obtained a calibration curve by measuring fluorescence of the QD probe/target DNA hybrid after staining (PicoGreen) • Fluorescence intensity increased rapidly with target concentration. 0.45 nm QD 3 µM target DNA Lim, S. et. al., Anal. Chem., 2010, 82, 886-891

  27. Effect of Oligonucleotide Density • Density of conjugated oligonucleotides on the QDs using 500, 1000, and 2000 pmol of oligonucleotides were 3.5, 15.6, and 71 molecules/QD • Change in photophysical properties of the QDs was negligible when oligonucleotide density was low • With an increase in oligonucleotide density, target capturing rate also increased. • Hybridization efficiency dropped with very high probe density 0.45 nm QD 400 µM target DNA Lim, S. et. al., Anal. Chem., 2010, 82, 886-891

  28. Effect of Probe Length 0.45 nm QD 400 target DNA µM • 18-mer QD probes show a 40% lifetime reduction and 50 % fluorescence quenching when hybridized with the 25-mer complementary target DNA • However, the 25-mer QD probes show a 30% lifetime reduction and a 40% fluorescence quenching Lim, S. et. al., Anal. Chem., 2010, 82, 886-891

  29. Quantitative Analysis of QD Probes and DNA Hybridization in a Portable Device Lim, S. et. al., Anal. Chem., 2010, 82, 886-891

  30. Conclusions • Single-step hybridization for detection • Simple and fast compared to conventional methods • Portable target detection system • Single-label and wash-free platform using the QD photophysical properties of fluorescence lifetime and quenching • QD probes were proved to be stable and homogenous • Applicable to biological samples

  31. DNA Sequence Detection Using Surface-Enhanced Resonance Raman Spectroscopy in a Homogeneous Multiplexed Assay Alexandra MacAskill, David Crawford, Duncan Graham, and Karen Faulds Anal. Chem. 2009, 81, 8134-8140

  32. Goal Detect different strains of hospital-acquired infections (HAI) based on specific DNA identification using a SERRS-based assay

  33. Surface-Enhanced Raman Spectroscopy (SERS) Pump SERS Signal Molecule Plasma Resonance Corrugated metal surface

  34. Combining Resonance Raman and SERS(Surface-Enhanced Resonance Raman) • Increase in signal intensity is roughly the product of the intensity produced by each of the techniques • Extends Raman Spectroscopy into a wide variety of interfacial systems that were previously inaccessible due to lack of sensitivity • Because the technique has the same capabilities as conventional Raman Spectroscopy, structural information can also be provided

  35. Hospital Acquired Infections (HAIs) • The Centers for Disease Control and Prevention estimates that HAIs roughly, cause or contribute to 99,000 deaths each year. • Can cause severe pneumonia, infections of the urinary tract, and the bloodstream “The patient in the next bed is highly infectious. Thank God for these curtains.” http://postmanpatel.blogspot.com/2008_07_27_archive.html

  36. Experimental

  37. Silver Nanoparticle (NP) Synthesis • EDTA was added to 2000mL of distilled H2O and heated on a hot plate. NaOH was added prior to boiling. • At 100 °C, silver nitrate was added and the solution boiled for 30 minutes • NP solution allowed to cool at room temperature and was analyzed using UV-Vis • Concentration of EDTA-reduced silver NPs was calculated to be 1.16 x 10-10 mol/L and average particle size was 36.8 nm At 100 °C EDTA/H2O + AgNO3 + NaOH UV-Vis Cool at room temp. Dilution MacAskill, A. et al., Anal. Chem. 2009, 81, 8134-8140

  38. Locked Nucleic Acid • Modified RNA nucleotide in which the ribose moiety has been modified with an extra bridge connecting the 2’ oxygen and 4’ carbon • The bridge “locks” the ribose in the 3’-endo conformation • Enhances base-stacking and backbone preorganization • Increase in hybridization specificity http://www.renatamusic.it/LNA.gif

  39. Polymerase Chain Reaction (PCR)

  40. Preparation of PCR Product • PCR products for femA-SA, femA-SE, and mecA were prepared using 4 µL of template DNA and a master mix of enzyme polymerase, nucleotides, and hybridization buffer, 4 µL each of 100 nM forward and reverse primers, and 38 µL of PCR grade water. • Repeated for 30 cycles  1 x 109 copies of the DNA template MacAskill, A. et al., Anal. Chem. 2009, 81, 8134-8140

  41. ASSAY with PCR Products Multiplexing • Dilution series prepared by varying the concentration of complementary PCR product to a fixed concentration of probe. • 1.8 µL of 1 µM probe was added to 18.2 µL of 100 nM PCR product (complementary or noncomplementary) • PCR product was further diluted with PCR product that contained no template DNA to obtain the dilution series. • Performed a triplex reaction using femA-SA FAM, femA-SE TAMRA, and mecA HEX LNA probes • Stock solutions of the LNA probes and complementary DNA sequences were prepared at concentrations of 1.0 x 10-6 mol dm-3 • The multiplexing samples were prepared using 10 µL of each of the 3 dye-labeled probes • 12 µL of each of the complementary sequences was then added or replaced with distilled H2O if absent. • 34 µL of PBS hybridization buffer was added MacAskill, A. et al., Anal. Chem. 2009, 81, 8134-8140

  42. Enhancing the Surface • Silver NPs are compatible with solution-based approaches to DNA detection by SERRS and can be readily prepared by the reduction of the corresponding metal salt using a reducing agent (i.e. citrate or EDTA) • Results in overall negative charge on the silver NPs Spermine surface layer Citrate or EDTA surface layer Silver Nanoparticle MacAskill, A. et al., Anal. Chem. 2009, 81, 8134-8140

  43. SERRS Detection Assay MacAskill, A., et al., Anal. Chem. 2009, 81, 8134-8140

  44. Results

  45. Producing the SERRS-active Probe LNA and DNA Sequences Used and the Corresponding Labels • Evaluated fluorescently labeled DNA sequences where every fourth base was modified to be an LNA residue • 3 different sequences used, either as DNA only or with the LNA • 3 different labels, FAM, HEX, and TAMRA were used for the identification of the sequences LNA Probe LNA Probe + Nonsense DNA LNA Probe + Complementary DNA SERRS Peak Intensity Raman Shift, cm-1 MacAskill, A. et al., Anal. Chem. 2009, 81, 8134-8140

  46. EDTA-reduced NPs • Citrate-reduced NPs gave more intense signals, however, the difference in signal between complementary and noncomplementary DNA was more marked when EDTA-reduced silver NPs were used. • Hybridization buffer had to be PBS-based to obtain the highest SERRS signal while maintaining quantitative and reproducible detection of the target DNA • The silver NPs were diluted to 50% within the SERRS sample • Tween 20 was also added to minimized nonspecific adsorption of the labeled single-stranded probes. (mol/L) MacAskill, A. et al., Anal. Chem. 2009, 81, 8134-8140

  47. Discrimination of Target DNA (femA-SA) LNA • Comparison of complete DNA probe and LNA probe • Discrimination of target DNA was examined a function of concentration • LNA probe showed greater discrimination between complementary (Red Line) and noncomplementary target (Blue Line) Conc. Of DNA (mol/L) DNA Conc. Of DNA (mol/L) MacAskill, A. et al., Anal. Chem. 2009, 81, 8134-8140

  48. Versatility and Applicability to Biological Samples • femA-SA, femA-SE, and mecA were used and have 142, 162, and 99 base pairs, respectively • PCR products were mixed with appropriate probe and underwent hybridization cycle • FAM-labeled and LNA and DNA probes containing the same base sequence were used for comparison Red-NC-PCR Blue-Com-PCR Red-NC-PCR Blue-Com-PCR HEX TAMRA LNA DNA Conc. of PCR Product (mol/L) Conc. of PCR Product (mol/L) Conc. of PCR Product (mol/L) Conc. of PCR Product (mol/L) MacAskill, A. et al., Anal. Chem. 2009, 81, 8134-8140

  49. Multiplexing • Authors wanted to detect species commonly present in an HAI swab. • DNA sequences used correspond to the femA gene in S. aureus (femA-SA) which will identify the presence of S. aureus, and the mecA gene, which codes for methicillin resistance in MRSA. • The sequence for the femA-SE gene in methicillin resistant S. epidermidis (MRSE) was also detected. MacAskill, A. et al., Anal. Chem. 2009, 81, 8134-8140

  50. Spectra of Labeled LNA Probe Sequences 1649 cm-1 femA-SE TAMRA 645 cm-1 747 cm-1 femA-SA FAM mecA HEX Triplex Spectrum MacAskill, A. et al., Anal. Chem. 2009, 81, 8134-8140

More Related