'De novo assembly' presentation slideshows

Introduction to NGS

798 views • 71 slides

Next Generation Sequencing and Bioinformatics Analysis Pipelines

581 views • 51 slides

518 views • 37 slides

RNA Assembly Using extending method.

321 views • 23 slides

Bioinformatics analysis pipeline for viral metagenomics

Bioinformatics analysis pipeline for viral metagenomics. Davit Bzhalava, PhD Dept. of Laboratory Medicine, Karolinska Institutet , Sweden. Human Microbiota. We are born 100% human and we die 90% microbial.

297 views • 23 slides

Genovo : De Novo Assembly for Metagenomes

Genovo : De Novo Assembly for Metagenomes. Gao Song 2010/07/14. Outline. Overview of Metagenomices Current Assemblers Genovo Assembly. Overview of Metagemices. Motivation. Metagenomics is: Why Do We Need Metagenomics ? Snapshot of bacterial community Cannot be cultivated. <1%.

407 views • 22 slides

genetic variation is meaningful only in the context of a population

ccagtcagag A tgtgcacatggcttagttttcataca G agcctgggctgggggtggggtg ccagtcagag A tgtgcacatggcttagttttcatacacagcctgggctgggggtggggtg ccagtcagagttgtgcacatggcttagttttcatacacagcctgggctgggggtggggtg ccagtcagag A tgtgcacatggcttagttttcatacacagcctgggctgggggtggggtg

233 views • 15 slides