1 / 8

Back to the future with transfusions? Terasaki Festschrift: Jim Cicciarelli

Back to the future with transfusions? Terasaki Festschrift: Jim Cicciarelli. I started as post doctoral fellow with Terasaki Labs in 1977.

seoras
Download Presentation

Back to the future with transfusions? Terasaki Festschrift: Jim Cicciarelli

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Back to the future with transfusions?Terasaki Festschrift: Jim Cicciarelli • I started as post doctoral fellow with Terasaki Labs in 1977. • When I accepted the position Paul sent 15 of his most recent manuscripts which started at 217-232 (quite impressive, I thought). When I left in 1990 publication numbers were ~700-800. • One of the major findings other than HLA matching known to work because of the results of chromosome matching, was the transfusion effect. The transfusion effect is the counter intuitive result which occurs if the patient was transfused better graft survival was foundeven though one would think that sensitization would make it worse. Opelz G, Mickey MR, and Terasaki P. Effect of blood bransfusions on subsequent kidney transpants. Transplant Proc. 5,253,1973.--Opelz G, Terasaki PI: Improvement of kidney-graft survival with increased numbers of blood transfusions. NEngl J Med 299: 799–803, 1978) • About a 10% 1year graft survival increase was noted for transfused versus not transfused patients • After the introduction of Cyclosporine in January 1984 the transfusion effect disapeared UNOS registry data clearly showed no differences in first grafts but transfused recipient regrafts showed a significantly better outcome at two and three years Cicciarelli JC, Iwaki Y. Blood transfusion effects in organ transplantation. In: Singal DP, editor. Immunological effects of blood transfusion. Boca Raton: CRC Press Inc; 1994. p. 43-61

  2. Festschrift (Cont.) • Further, Opelz et al. performed the first randomized clinical trial of pretransplant blood transfusions on graft outcomes. A total of 423 prospective cadaveric kidney transplant recipients from 14 European centers were randomly assigned to receive three pretransplant packed cell transfusions (n=205) or transplants without transfusions(n=218) (19). • The graft survival rate was significantly higher in the transfusion recipients than in patients who did not receive transfusions (at 1 year: 90% versus 82%, P=0.02; at 5 years: 79% versus 70% P=0.03, Opelz G, Vanrenterghem Y, Kirste G, et al: Prospective evaluation of pretransplant blood transfusions in cadaver kidney recipients. Transplantation 63: 964–967, 1997 • The dimunition of the transfusion effect was thought to be a linked to the autocrine IL-2 signaling for all T cells for effector cells as well as supressor cells post- TX • However, because transfusions also result in sensitization transfusion protocols are largely abandoned • One of the mechanisms of the transfusion effect may be due to tolerance induction by the generation of Treg cells---which occur as follows:

  3. Decreased Th2 cytokines due to T cell tolerance Suppression of Th0/Th1/Th17 Effector cells Suppression of Th1/Th17/Th22 Effector cells pro-inflammatory Th response Th22 Th1 Th17 Th2 IL-10 TGFbeta Treg Th2 IL-10 TGFbeta Th2 Basophil Mast cell IgE plasma cell IL-10 TGFbeta B-cell Induction of IgG4 blocking antibody and suppression of IgE by IL-10 and Treg cells alternately suppression of complement fixing antibodies. IgG4 is the hallmark of Treg and anti-inflamatory response

  4. Allergic desensitization as a model for HLA specific tolerance: Generation of allergen specific tolerance The allergen specific tolerance results from escalating antigen doses injected subcutaneous over a period of months or years. Desensitization occurs as a result of generation of T-regulatory (Treg) cells. Typically IgG4 occurs as a result of the Treg influence of IL-10 and TGFbeta. In pretransplant patients IgG4 is an effective blocking and successful transplants can be performed with a positive cross match if it is due to IgG4 Lobashevsky A, Rosner K, Goggins W, Higgins N. Subtypes of immunoglobulin (Ig)-G antibodies against donor class II HLA and cross-match results in three kidney transplant candidates. Transplant Immunol 2010; 23: 81–5. In some post transplant patients with DSA, we can see class switching to IgG4 in patients with long term graft function. The following heart TX has been followed for the last four years with predominantly IgG4 antibodies and no dysfunction

  5. Table 4. four year monitoring of HRTX FF recipient with strong DSA and stable function DSA MFIs by single antigen Luminex and IgG subclass analysis • Heart transplant recip with a DSA of ~16,000 MFI but no dysfunction • IgG subclass antibodies were monitored for out to 10/13 and IgG4 was the predominant subclass and no graft dysfunction • Using the successful clinical application of allergic desensitization as a model, we should be able to extend protocols in order to desensitize patients to HLA with a resultant tolerant and IgG4 as a marker. • HLA in the form of purified antigens or transfusions may be potentially used

  6. Paul Terasaki Festschrift January 26, 2014, Los Angeles, CA Reduction of HLA Class I Expression by RNA Interference Mitigates Allogenicity of Human Primary and Immortalized Cells Nathan A. Lemp PhD1,2, Kazunori Haga MD PhD2, Katrin Hacke PhD2, Janet Treger PhD2, Brooke Bogan BSc2, Emmanuelle Faure-Kumar PhD2, Christopher R. Logg PhD2, Carol A. Kruse PhD3, Noriyuki Kasahara MD PhD1,2, James C. Cicciarelli PhD1 1. Mendez National Institute of Transplantation, Los Angeles, CA, USA 2. Dept. of Medicine, University of California, Los Angeles (UCLA), USA; 3. Dept. Of Neurosurgery, University of California, Los Angeles (UCLA), USA

  7. Sequences specific to HLA -A*020101 allele : A2-1: GGATTACATCGCCCTGAAAG A2-2: GCAGGAGGGTCCGGAGTATT A2-3: GGACGGGGAGACACGGAAAG A2-4: GAAAGTGAAGGCCCACTCA Sequences common to HLA- A, B, C alleles : ABC-1: GATACCTGGAGAACGGGAAG ABC-2: GCTGTGGTGGTGCCTTCTGG ABC-3: GCTACTACAACCAGAGCGAG ABC-4: GTGGCTCCGCAGATACCTG shRNAlentiviralvector achieves effective knockdown of HLA

  8. HLA-knockdown in primary human CD34+ cells confers vector dose-dependent resistance to complement-directed cytotoxicity LV-control (DsRed only) LV-ABC shRNA Untransduced MFI: 3.64 MFI: 3.10 MFI: 3.03 Isotype control Ab control DsRed (vector) LV-ABC shRNA MFI: 24.78 MFI: 30.62 MFI: 8.04 Anti-HLA- ABC FITC (anti-HLA-ABC) HLA knockdown by lentiviral vector delivery of shRNA may be a valuable tool for reducing immunogenicity in allogeneic transplantation. Condition the graft, not the host! Supported by the MNIT Foundation, UCLA Center for Biological Radioprotectors (U19 AI067769), and California Institute for Regenerative Medicine (RS1-00402-01)

More Related