18S rRNA clone library of phytoplankton in the Columbia River and its coastal zone

1. 1 18S rRNA clone library of phytoplankton in the Columbia River and its coastal zone By Pete Kahn Mentors: Lydie Herfort and Peter Zuber

2. 2 Significance of phytoplankton Major primary producers: O2: 90% CO2=>C3: 50% Most abundant eukaryotes: 102 to 104 cells/ mL Base of aquatic food chain

3. 3 Interactions with other Domains

4. 4 Traditional Methods Microscopy Flow Cytometry Pigment analysis: Chl a Photosynthesis: O2 production C14 uptake

5. 5 Molecular Methods for eukaryotes Pitfalls of Traditional methods: -Microscopy: focus on numerous, �big� organisms; time consuming -Incomplete understanding of diversity Molecular Methods: nucleic acid extraction, PCR, cloning, sequencing Pitfalls of Molecular Methods: biases in PCR primers & preferential amplification of some organisms, i.e. dinoflagellates vs diatoms

6. 6 Problems for phytoplankton Traditional methods studies >>>> molecular methods studies Prokaryotic molecular studies >>>> phytoplankton molecular studies

7. 7 18S rRNA clone library for: April: Wecoma & Forerunner: salinity gradient Wecoma (CR4s, CR15s, CR30s, CR40s): 20-32 psu; coastal surface samples Forerunner (St 1-5): estuary samples 0-20 psu, inc. of 5 June & July: Forerunner: 0 psu & 30 psu from estuary The sampling plan

8. 8 Sample Dates & Locations

9. 9 Goals within CMOP Short term: -Good clone library of phytoplankton -Determining good primers for isolating 18S rRNA Long term: -Understand changes in populations between seasons and locations -Better understand unexpected changes in community: monitor ecosystem health -Bacteria & Archaea relationships/ interactions (Dan Murphy) -Better understanding of microbial ecosystem as a whole

10. 10 What we know about Columbia River phytoplankton Anderson GC. 1972. Aspects of marine phytoplankon studies near the Columbia River with special reference to subsurface chlorophyll maximum. The Columbia River estuary and adjacent ocean waters, University of Washington Press, Seattle, WA, p. 219-240. Contaminant ecology of fish and wildlife of the lower columbia river-final report. April 1996. Lower Columbia River Bi-State Program. Frey BE, R Lara-Lara, LF Small. 1984. Primary production in the Columbia River Estuary water column. Columbia River Estuary Data Development Program.

11. 11 What we know about Columbia River phytoplankton Estuary: >50 species of diatoms; Asterionella formosa; Asterionella kariana; Skeletonema Costatum; Thallasiosira; Stephanodiscus hatzschii Coastal: Chaetoceros convolutus; Dactyliosolen mediterraneus; Thalassionema nitzschioides

12. 12 Variations in nucleic acid in environmental samples Between seasons Between locations April Wecoma & Forerunner: Freshwater << Surface Coastal

13. 13 Methods Overview

14. 14 Extraction/ DNA removal Extraction with LETS buffer + Phenol Chloroform DNA removal with TURBO DNA free kit or Ribopure kit

15. 15 PCR Primers: Euk A: AACCTGGTTGATCCTGCC Euk B: TGATCCTTCTGCAGGTTCACCTAC Specific for eukaryotes, Examined with BLAST: highly conserved PCR cleanup with MO-BIO ultra clean kit

16. 16 Cloning/ Transformation TOPO TA Cloning Kit Transformation with Top 10 chemical competent cells => E. coli Plated onto LB XGAL-AMP plates -Selective: cells gain ampicillin resistance from plasmid -Differential: cells w/plasmid insert turn white cells w/ no insert turn blue

17. 17 Plasmid isolation (miniprep) For 96 well plate, no miniprep. Send to Washington University Recover plasmid from E. coli host Clean plasmid and prepare to concentration of 100 ng/ ul Take to primate center for sequencing

18. 18 Sequences from April St 1 (0 psu): Rhizophydium St 4 (15 psu): Pseudopedinella elastica; Protperidinium leonis; Katablepharis japonica CR4s (27 psu): Asterionella kariana*; Thalassiosira aestivalis* Pirsonia guinardiae Gyrodinium rubrum CR 15s (20 psu): Thalassiosira pseudonana*:

19. 19 Sequences from Station 1 (0 psu) June Skeletonema costatum* -Diatom; extremely abundant in temperate areas Aulacoseira ambigua -river diatom Stephanodiscus hantzschii* -eutrophic freshwater diatom Cyclotella meneghiniana -river diatom; areas of high conductivity

20. 20 Next step Use multiple primer sets to decrease PCR biases Traditional methods: Chl a analysis; Flow cytometry; Primary productivity rates Apply protocol to ETM on future cruises

21. 21 Acknowledgements Lydie and Peter Michiko Nakano Dan Murphy Everyone in Peter & Michiko�s labs Michael Wilkin & the crew of the Forerunner Antonio Baptista NSF All of you