1 / 10

Estimation example

Estimation example. Input: Alignment. Model parameters from neutral sequence. Estimation example 2. HMM version. Different gene conservation patterns. Protein Coding Gene. ch10. Known non- coding gene: XIST. chX. RepA. Estimating.

shelby
Download Presentation

Estimation example

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Estimation example • Input: • Alignment. • Model parameters from neutral sequence

  2. Estimation example 2

  3. HMM version

  4. Different gene conservation patterns Protein Coding Gene ch10 Known non-coding gene: XIST chX RepA

  5. Estimating Decompose Q by “extracting” the stationary distribution: R: Neutral substitution pattern : Site specific forces Find a ML estimator for using the EM algorithm. Score:

  6. Comparison Rate Score Unlikeliness Score

  7. Proof of concept 43% vs 16% detection by vs.

  8. Gene and gene regulation

  9. A generalization: Conserved motif discovery Human GTACTAAGCTACTGTATGGAGGCT Mouse *****GAGC**********ATGC* x x Dog *****AGGT**********CGGC* x Bat *****AGCT**********AGAC* Find regions in the alignment whose substitution pattern is explained by the motif.

  10. P53 Motif instance conservation P53 Novel non coding gene MDM2 M. Huarte, O. Zuk, M. Guttman

More Related