1 / 24

Protein Synthesis

Protein Synthesis. What is a nucleotide?? What are the base pairing rules in DNA?? In RNA?? What is the structure of the DNA?. Knowledge Check. Protein synthesis is the process by which genes within DNA are decoded into instructions for protein production in the cells.

shiloh
Download Presentation

Protein Synthesis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Protein Synthesis

  2. What is a nucleotide?? • What are the base pairing rules in DNA?? • In RNA?? • What is the structure of the DNA? Knowledge Check

  3. Protein synthesis is the process by which genes within DNA are decoded into instructions for protein production in the cells. • This process takes place in three steps: -Step 1→ Transcription -Step 2→ Translation -Step 3 → Amino Acid Formation

  4. Protein Synthesis

  5. Is a nucleic acid • Consist of a long chain of nucleotides • Three types of RNA: -mRNA: serves as messengers from DNA to the rest of the cell -rRNA: makes up the ribosomes, clamps on to mRNA and uses its information to assemble amino acids -tRNA: transports amino acids to the ribosomes to be assembled into proteins. RNA

  6. Sugar in RNA →ribose • Sugar in DNA→deoxyribose • RNA → single-stranded • DNA → double stranded • RNA contains uracil • DNA contains thymine DNA vs RNA

  7. In the nucleus, enzymes make an RNA copy of a portion of DNA Requires an enzyme called RNA polymerase During transcription, RNA polymerase binds to DNA and separates the DNA strands. RNA polymerase then uses one strand of DNA as a template strand to form RNA Step 1→Transcription

  8. DNA unwinds, becomes single stranded. Serves as template for synthesizing mRNA • mRNA molecules move to nucleus where specific codes are transcripted and carried into cytoplasm A(from DNA)U(RNA) C (from DNA) G T(from DNA)A Steps in depth-TRANSCRIPTION

  9. Results of Transcription -one single-stranded RNA molecule is formed -mRNA is produced http://highered.mcgraw-hill.com/sites/0072507470/student_view0/chapter3/animation__mrna_synthesis__transcription___quiz_1_.html

  10. AATGCCATTAATCGCCGGATGACT Practice Transcription from this sequence of DNA

  11. What is the structure of RNA? What are the results of transcription? What is the enzyme that is required for transcription? Knowledge Check

  12. language of the mRNA is translated into the language of proteins Takes place in the ribosomes tRNA transfers amino acids to the site of the growing protein chain (polypeptide). 3 steps initiation, elongation, termination Translation

  13. Translation begins at the start codon AUG Each tRNA molecule recognizes a specific, three base-pair mRNA code or codon Anti-codon: A sequence of three adjacent nucleotides located on one end of transfer RNA Translation Video Translation

  14. When trying to find the amino acid sequence it is important to remember that you are only reading from the mRNA codons NOT the tRNA anti-codons Translation

  15. Stop codons are present. UAA, UGA, UAG is the stop codon that signals for the termination of the protein synthesis process. DOES NOT CODE FOR AN AMINO ACID How does the ribosome know when to stop reading?

  16. The nucleotide sequence transcribed from DNA to RNA acts as a genetic message protein synthesis video

  17. What is a code? -A system of words, letters, figures, or other symbols used to represent others • Living organisms have their own code called the genetic code

  18. the language of the mRNA instructions What is the Genetic Code?

  19. it is read three letters at a time Ex: UCGCACGGU ↓ UCG-CAC-GGU ↓ Serine-Histidine-Glycine Codons represent the different amino acids Genetic Code Video What is the Genetic Code?

  20. AMINO ACID CODE CHART- THIS CHART CONVERTS ALL THE m-RNA messages into aa

More Related