1 / 25

Research Repository for Heritable Disorders

Research Repository for Heritable Disorders. University of Washington - Department Pathology Peter Byers, MD Ulrike Schwarze, MD Melanie Pepin, MS, CGC Dru Leistritz, MS.

signa
Download Presentation

Research Repository for Heritable Disorders

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Research Repository for Heritable Disorders University of Washington - Department Pathology Peter Byers, MD Ulrike Schwarze, MD Melanie Pepin, MS, CGC Dru Leistritz, MS The Research Repository is housed alongside the Collagen Diagnostic Laboratory, a certified clinical laboratory that provides testing and consultation for patients with suspected connective tissue disorders. Having DNA, tissues and clinical information from individuals with the disease – essential to our research work.

  2. Research Repository for Heritable Disorders RECRUITMENT FOR CLINICAL RESEARCH STUDIES • Diagnostic Testing Samples – Repository Consent is optional. • Internet recruitment via EDNF or EDSCares. • Recruitment at EDS meetings – e.g. currently enrolling for Pregnancy in EDS type IV study • Each study is approved by the University of Washington Human Subjects Committee (IRB).

  3. Research Repository for Heritable Disorders of Bone, Blood Vessels and Skin • Gene Identification for a CLINICAL DIAGNOSIS – Periodontal EDS • Clinical Test Development after Gene Identification – Classical EDS and Hypermobility EDS • Understanding Disease Process – Genotype-Phenotype Relationship – Vascular EDS • Natural History Study: Evidence-based Clinical Care – Vascular EDS Pregnancy Study

  4. Research Repository for Heritable Disorders of Bone, Blood Vessels and Skin • Gene Identification for a CLINICAL DIAGNOSIS – Periodontal EDS • Clinical Test Development after Gene Identification – Classical EDS and Hypermobility EDS • Understanding Disease Process – Genotype-Phenotype Relationship – Vascular EDS • Natural History Study: Evidence-based Clinical Care – Vascular EDS Pregnancy Study

  5. EDS type VIII – Distinct Clinical Phenotype Mutation Unknown Joint Hypermobility & Stretchy Skin Tissue fragility following repeated trauma to an injury-prone area. Bleeding tendency & delayed wound healing. Severe gingival recession (16yo) Mataix et al B J Dermatology 2008

  6. RR is pairing with by Dr. Debbie Nickerson in UW Genome Sciences department on an NIH-funded project to attempt to find disease yet-undiscovered genes for rare disorders. Current Project: Whole Exome Sequencing of DNA in families with EDS type VIII, the periodontal form of EDS. 1. Gene Identification for a CLINICAL DIAGNOSIS of Periodontal EDS

  7. DNA Sequence Exons translate to PROTEINS

  8. GGTGACCGTGGTGAGACCGGCCCC Control GGTGACCGTGGTGAGACCAGCCCC G1040S GGC>AGC

  9. EDS type VIII – Exome Sequencing Strategy • EXOME – 2% of genome but 85% of mutations. 20,000 genes. Thousands of variants in sequence. • Those studied must have the same clinical diagnosis. • Choose: • Multiple members of one family • 2. Several unrelated individuals with identical phenotype

  10. 2009 First Whole exome sequencing

  11. Research Repository for Heritable Disorders of Bone, Blood Vessels and Skin • Gene Identification for a CLINICAL DIAGNOSIS – Periodontal EDS • Clinical Test Development after Gene Identification – Classical EDS and Hypermobility EDS • Understanding Disease Process – Genotype-Phenotype Relationship – Vascular EDS • Natural History Study: Evidence-based Clinical Care – Vascular EDS Pregnancy Study

  12. Causative Genes: Classical EDS (EDS type I and II) Alterations in type V collagen genes: COL5A1 and COL5A2 Tenascin-X deficiency - XB gene Other - unknown 40-50% 5/151 EDS cases Bristow 2001

  13. Tenascin X deficiency: Classical EDS-like Syndrome • Schalkwijk et al., 2001reported the 5 (of 151 screened) patients with an EDS syndrome with deficiency of Tenascin X protein– an extracellular matrix protein resulting from recessive mutations in the encoding XB gene. • hypermobile joints • hyperextensible skin • easy bruising • slow wound healing, but normal scar formation • autosomal recessive “This finding indicates that factors other than the collagens or collagen-processing enzymes can cause the syndrome and suggests a central role for tenascin-X in maintaining the integrity of collagenous matrix. (N Engl J Med 2001;345:1167-75.)”

  14. XB Mutations absent Tenascin X

  15. Tenascin X Regulates Fibril spacing Associates with other matrix proteins to make this happen

  16. Tenascin X heterozygosity: What is the role of TNX in Hypermobility EDS? Zweers 2003 Test obligate relatives id’d 9/23 obligates with significant joint Hypermobility. Puzzling finding was that this was most often found in females. Zweers 2004 Measured TNX in 80 unrelated hypermobility EDS patients and found 5-10% with very low levels. Heterozygous TNX mutation found in 2.

  17. Consequence of the TNX gene sequencing Sequencing of gene that encodes TNX protein already complete Setting up a systematic way to sequence over 50 exons at one time Offer as testing to classical EDS without wide gaping scars Consider a pilot test of hypermobile EDS to determine test sensitivity

  18. Research Repository for Heritable Disorders of Bone, Blood Vessels and Skin • Gene Identification for a CLINICAL DIAGNOSIS – Periodontal EDS • Clinical Test Development after Gene Identification – Classical EDS and Hypermobility EDS • Understanding Disease Process – Genotype-Phenotype Relationship – Vascular EDS • Natural History Study: Evidence-based Clinical Care – Vascular EDS Pregnancy Study

  19. Does the Mutation Type determine clinical outcome ? Is there a Genotype/Phenotype Correlation? COL3A1 Mutation Types Alteration in type III collagen structure Reduction in type III collagen – “null”

  20. Understanding Disease Process – COL3A1 Mutations – Genotype/Phenotype Correlation The EDS IV natural history study in 2000 did not find a significant difference in complications when comparing families with different mutations (Pepin et al 2000) n=135 No null mutations Missense N=400 Null (nonsense) n=21 Dru Leistritz is leading a study in the RR to review clinical data of consented “null” families to compare them with previously reported families. Data will be presented at the November ASHG meeting 2010. Preliminary data confirms significant difference in age of complications and age of ascertainment in null families. (e.g age of first complication 24 v 38)

  21. Research Repository for Heritable Disorders of Bone, Blood Vessels and Skin • Gene Identification for a CLINICAL DIAGNOSIS – Periodontal EDS • Clinical Test Development after Gene Identification – Classical EDS and Hypermobility EDS • Understanding Disease Process – Genotype-Phenotype Relationship – Vascular EDS • Natural History Study: Evidence-based Clinical Care – Vascular EDS Pregnancy Study

  22. Natural History Study: Contribution to evidence-based Clinical Care EDS type IV – Pregnancy Study Enrollment is Open Women with EDS type IV who have undertaken pregnancies are recruited and interviewed (or records reviewed) to detail successes and problems encountered. Study is being done in collaboration with UWMC MFM physician, Dr. Suzanne Peterson Primary Procedure: Phone Interview and Record Review Goal: Establish evidence-based pregnancy care guidelines Evaluate the factors at play in decision-making about undertaking a pregnancy.

  23. Research Repository for Heritable Disorders of Bone, Blood Vessels and Skin Financial Support Donations to UW Collagen Research Laboratory (private donations from families, friends to UW (Byers)) 2009 Freudman Fund - family foundation to support research in EDS (basic science research and clinical research) and related connective tissue disorders “ because of the interest and generosity of patients and families with EDS”

  24. Tenascin X deficiency: Classical EDS-like Syndrome • Schalkwijk et al., 2001reported the 5 (of 151 screened) patients with an EDS syndrome with deficiency of Tenascin X protein– an extracellular matrix protein resulting from recessive mutations in the encoding XB gene. • hypermobile joints • hyperextensible skin • easy bruising • slow wound healing, but normal scar formation • autosomal recessive “This finding indicates that factors other than the collagens or collagen-processing enzymes can cause the syndrome and suggests a central role for tenascin-X in maintaining the integrity of collagenous matrix. (N Engl J Med 2001;345:1167-75.)”

More Related