Regulation of gene expression

1. Regulation of gene expression 11-30-2015

2. Liver Cells Brain Cells In differentiated cell, the non-expressed genetic information is deleted out (totally lost) or switch off (temporally inactivate)?

3. 完全分化的體細胞仍然擁有完整的遺傳資訊！ Gurdon, J.B. & Uehlinger, V. Nature 210, 1240–1241 (1966)

4. 它是誰？

6. Regulation of gene expression • Transcriptional level • control of transcription initiation. • Post transcriptional level • Alterative splicing • Stability of mRNA • Translational level • control of translation initiation • Post translational level • Protein stability • Reversible chemical modification • Irreversible modification

7. How lac operon was discovered The first case of gene expression regulation at transcriptional level in E. coli

8. "diauxic growth" J. Monod, Recherches sur la Croissance des Cultures Bactériennes, Hermann, Paris, 1941.

9. Beta-galactosidase activity Two question: 1, how lactose induce beta-galactosidase activity? 2, how glucose suppress lactose induce enzyme activity?

10. Take home question: What message you learn from this experiment?

11. Regulatory mutations in the lacI gene (lac Z ) (lac A ) b-galactosidasetransacetylase Genotype-IPTG+IPTG -IPTG+IPTG Conclusion I+Z+A+<0.1 100 <1 100 Inducible I+Z-A+<0.1 <0.1 <1 100 I -Z +A +100 100 100 100 Constitutive I+Z -A+ /F' I -Z +A+<0.1 100 <1 200 I+ >I -action in trans • The lacI gene encodes a trans-acting factor (protein) • needed for repression (repressor). • Most lacI- mutants are constitutive.

12. Regulatory mutations in the operator b-galactosidase Genotype-IPTG+IPTG Conclusion I +o +Z +<0.1 100 Inducible I +o C Z +100 100 Constitutive I +o C Z + / F' I +o +Z -100 100 Constitutive I +o C Z - / F' I +o +Z +<0.1 100 Inducible Loss-of-function alleles of the operator confer a constitutive phenotype on the operon. They are called oC. The operator acts in cis, i.e. it affects the allele to which it is linked. The allele of the operator that is in cis to the active reporter gene is the dominant allele. The operator shows cis -dominance.

13. Regulatory mutations in the lacI gene (lac Z ) (lac A ) b-galactosidasetransacetylase Genotype-IPTG+IPTG -IPTG+IPTG Conclusion I sZ +A+<0.1 <1 <1 <1 Noninducible I sZ +A+ /F' I+Z +A+<0.1 1 <1 1 I s >I+ in trans The lacIS allele is noninducible. What is the possible mechanism?

14. RegulatoryGene Operon DNA i p o z y a m-RNA Protein -Galactosidase Transacetylase Permease Lactose Operon • Structural genes • lac z, lac y, & lac a • Promoter • Polycistronic mRNA • Regulatory gene • Repressor • Operator • Operon • Inducer - lactose

15. Absence of lactose z y a i p o Active No lac mRNA Presence of lactose z y a i p o Inactive -Galactosidase Permease Transacetylase Lactose Operon • Inducer -- lactose • Absence • Active repressor • No expression • Presence • Inactivation of repressor • Expression • Negative control

18. - glucose Units of -galactosidase Glucose added + glucose Time (hr) + lactose Catabolite Repression (Glucose Effect) • Definition: Control of an operon by glucose • Catabolic operons

19. Adenyl cyclase Absence of glucose c-AMP ATP CAP i z y a p o Active Inactive -Galactosidase Permease Transacetylase Maximum expression Mechanism of Catabolite Repression • c-AMP • CAP (CRP) protein • CAP-cAMP complex • Promoter activation • Positive control

20. Presence of glucose CAP Adenyl cyclase X ATP Low level expression z y a i p o Inactive -Galactosidase Permease Transacetylase Mechanism of Catabolite Repression • Glucose:cAMP • CAP (CRP) protein • No CAP-cAMP complex • No Promoter activation cAMP

21. Activator binding site Promoter Operator TTTACA TATGTT -72 -52 -35 -10 +1 +11 a b b ' s Repressor cAMP-CAP RNA polymerase lac regulatory region

22. There are 3 lac operators and all three operators are important!

23. Lac repressor binds as a tetramer, with each operator is contacted by a repressor dimer. Why tetrameric repressor is better than dimeric repressor ?

24. How eucaryotic gene expression is regulated? Same principle but more complicated!

25. Promoters, enhancers, silencers etc.

26. …AGCCTACCAAAAAAGGTTCCACG… …TCGGATGGTTTTTTCCAAGGTGC… RNA polymerase is responsible for transcription, but transcription factors turn genes on and off. Transcription factors are proteins that recognize and bind to a specific base sequence in DNA.

30. Regulatory RNAs:Riboswitch; • RNA interference; microRNA and lncRNA

31. How RNA interference was discovered? An unexpected observation from control experiment!

34. How to isolate genes for RNA interference in C. elegant? Normal worm die after a few days Isolation of mutants which is alive under the same situation and then identify which gene is mutated that make RNA interference lost !

37. What is miRNA?

38. The first miRNA was discovered in C. elegans. lin-14(lf) mutations caused precocious development. lin-14(gf) and lin-4 mutations caused retarded development. wild type: embryo L1 L2 L3 L4 adult preccious: embryo L2 L3 L4 adult retarded: embryo L1 L1 L2 L3….. lin-14(lf); lin-4(lf) mutants are precocious. LIN-14 is a repressor of embryo development LIN-4 is a negative regulator of LIN-14

39. lin-14 gene (simplified) loss-of-function gain-of function mutations in coding sequencesmutations in 3’UTR lin-4 encodes no protein. Only an RNA. LIN-14 RNA always present, but protein decreases through larval development (lin-14 protein plays as negative regulator for larval development). lin-4 required for LIN-14 decrease. lin-4 RNA increases though larval development. lin-4 RNA potentially could base pair with lin-14 3’ UTR.

40. lin-4 lin-14 LIN-14 protein in lin-14(gf) or lin-4(lf) LIN-14 protein lin-4 RNA LIN-14 protein in wild type Developmental time

42. miRNA complex contains Risc proteins

43. Characteristics of miRNAs Small non-coding double stranded RNAs Approximately 19-22 nt long Repressive activity of complementary mRNAs Regulate 30% of mammalian gene products 1 miRNA = hundreds of mRNAs To date, nearly 8600 miRNA genes have been identified among 73 eukaryotic organisms (plants and animals) and 15 viruses There are, for example 132 C. elegans, 78 Drosophila, 377 mouse, and 474 human miRNA genes Many are conserved between vertebrates and invertebrates

44. Conservation of miRNA sequence and structure • Certain miRNAs are highly conserved and thus evolutionarily ancient (e.g. let-7) • Sequence conservation must fulfill the require to form a dsRNA hairpin from which the miRNA is processed by Dicer

45. Genomic Organization

46. miRNA processing Microprocessor Complex

47. Differences in miRNA Mode of Action

48. CORRELATION OF MIR EXPRESSION WITH PROGRESSION AND PROGNOSIS OF GASTRIC CANCER* PATIENTS: 181 patients from 2 cohorts (Japan) CLASSIFICATION: Stages I-IV Diffuse vs. Intestinal type ANALYSIS: • Custom miR microarray chip (Ohio State Univ.) • miR expression in 160 paired samples • (tumor vs. non-tumor) • Correlations of miR expression vs. stage, • type and prognosis (survival) • * Lancet Oncol. 11,136, 2010

49. MiRs AS PROGNOSTIC FACTORS: GASTRIC CANCER SURVIVAL* Intestinal-Type Gastric Cancer miR-495 10 5 miR-199 9 8 4 7 3.2 6 3 5 HAZARD RATIO (disease free survival) HAZARD RATIO (disease free survival) Let-7g 4 2 3 1 2 1 0 0 Stages III-IV low low high Stages I-II high high low I-II III-IV I-II I-II III-IV III-IV

50. What is lincRNAs? Large intergenic noncoding RNAs (lincRNAs) are emerging as key regulators of diverse cellular processes. Determining the function of individual lincRNAs remains a challenge. Recent advances in RNA sequencing (RNA-seq) and computational methods allow for an unprecedented analysis of such transcripts.