1 / 7

Jonathan Kindberg BNFO 301 04/24/2013

Is there a correlation between similar cluster phages’ tandem repeats within the tape measure protein and its location within that gene?. Jonathan Kindberg BNFO 301 04/24/2013. Tape Measure Protein.

soren
Download Presentation

Jonathan Kindberg BNFO 301 04/24/2013

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Is there a correlation between similar cluster phages’ tandem repeats within the tape measure protein and its location within that gene? Jonathan Kindberg BNFO 301 04/24/2013

  2. Tape Measure Protein • Tail of a phage is used to inject it’s DNA into the host bacterium, which is the beginning of lysis. • The tape measure protein got its name because the length of the corresponding gene is proportional to the length of the phage's tail: a fact shown by actually copying or splicing out parts of DNA in exemplar species [1]. • Tandem Repeats are the tell tale sign of the tape measure protein

  3. Tandem Repeats • Tandem repeats occur when more than one nucleotide is repeated • The nucleotide repeats lie adjacent to each other within the gene. • TR example: ATGTAAGCTAAGCTAAGCTTG • The tandem repeat consists of TAAGC

  4. Experimental Procedure • Phagesdb.org to look at similar cluster phages • Look for tandem repeats in he genomes to find the tmp gene with the use of PhAnToMe/BioBIKE • PhAnToMe/BioBIKE functions will include SEQUENCE-SIMILAR-TO and ALIGNMENT-OF • Scatter plot of the phages tandem repeats vs. location in their genome will be graphed • Analysis of experimental findings

  5. Experimental Tools • Phagesdb.org • PhAnToMe/BioBIKE • Tandem Repeat Finder • Blast • Oracle Virtual Machine • Allows me to find phamerator maps of annotated phages.

  6. Results • TBD

  7. References • The evolution of the tape measure protein: units, duplications and losses: Belcaid M, Bergeron A, Poisson G. BMC Bioinformatics. 2011 Oct 5;12 Suppl 9:S10. doi: 10.1186/1471-2105-12-S9-S10.http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3271669/ • Length Determination in Bacteriophage Lambda Tails. Katsura, I and Hendrix, R. Cell, Vol . 39, 691-698, December 1984. http://ac.els-cdn.com/0092867484904768/1-s2.0-0092867484904768-main.pdf?_tid=46972fa4-9c69-11e2-b6bc-00000aab0f26&acdnat=1364998854_34031474c286eed57d3f1aadfd1a1d92 • Mechanism of Length Determination in Bacteriophage Lambda Tail. Katsura, Isao. Department of Biology, College of Arts and Sciences, The University of Tokyo, Meguro-ku, Tokyo 153, Japan. Adv. Biophys., Vol. 26, pp. 1-18 (1990).

More Related