iGem 2004 review

1. iGem2004 review

2. Significant differences between initial and final design. 0 0 1 0 0 0 0 1 1 0 Int1 Xis1 Int2 Xis3 Int2 Xis2 Initial design PLtetO rbs xis2 attB rbs gfp attP* t0 rbs int2* Final design

3. How did this work, and what was the problem? 0 0 1 0 0 0 0 1 1 0 Int1 Xis1 Int2 Xis3 Int2 Xis2 • Counting mechanism: • Initial state: 0 0 0 • Pulse 1: 1 0 0 • Pulse 2: 0 1 0 • etc. . . . • Race condition problems between each Int and Xis: • Ordering of signal arrival for an input is critical for correct behavior • Possible erroneous outputs caused by latency? Design 1. Slide 59

4. First design: two half-(?) bits that are coupled. Pulse 1 Int 2 Term X 2 GFP AttR AttL* Pulse 2 Int 1 Term X 1 CFP AttP AttB* Design 2. Slide 9: pulse 1a:0,2a:YFP,1b: GFP,2b:0

5. Two bits Pulse 1 Int 2 Term X 2 GFP AttR AttL* Pulse 2 Int 1 Term X 1 CFP AttP AttB*

6. Pulse 1a Output : 0 (state 1) Pulse 1 Int 2 Term X 2 GFP AttR AttL* Pulse 2 Int 1 Term X 1 CFP AttR AttL*

7. Pulse 2a Output : Yellow (state 2) Pulse 1 Int 2 Term X 2 GFP AttP AttB* Pulse 2 Int 1 Term X 1 CFP AttR AttL*

8. Pulse 1b Output : Green (state 3) Pulse 1 Int 2 Term X 2 GFP AttP AttB* Pulse 2 Int 1 Term X 1 CFP AttP AttB*

9. Pulse 2b Output : No (state 1) Pulse 1 Int 2 Term X 2 GFP AttR AttL* Pulse 2 Int 1 Term X 1 CFP AttP AttB*

10. Blue Heron design differs slightly. Why? Pulse 1 Int 2 Term X 2 GFP AttR AttL* Pulse 2 Int 1 Term X 1 CFP AttP AttB* Design 2. Slide 9: pulse 1a:0,2a:YFP,1b: GFP,2b:0 p22 Int+ LVA λattP Terminator λattB (rev comp, 2) P22 Xis +AAV EYFP +AAV p22 Half Bit BBa_I11061 : BBa_I11030 BBa_I11023 BBa_B0013 BBa_I11022 BBa_I11031 BBa_E0034 λ Int+ LVA p22 attP Reverse Terminator p22 attB (rev comp) λ Xis +AAV ECFP +AAV λHalf Bit BBa_I11060 : BBa_I11020 BBa_I11033 BBa_B0025 BBa_I11032 BBa_I11021 BBa_E0024 Design 3. Slide 11: 1a:0, 2a: 0, 1b: YFP, 2b: GFP

11. These[1] were synthesized, all now Bio-bricks. However, they were not completed by the time of the presentation. Work shown in the following slides indicates that this design will not work. p22 Int+ LVA λattP Terminator λattB (rev comp, 2) P22 Xis +AAV EYFP +AAV p22 Half Bit BBa_I11061 : BBa_I11030 BBa_I11023 BBa_B0013 BBa_I11022 BBa_I11031 BBa_E0034 λ Int+ LVA p22 attP Reverse Terminator p22 attB (rev comp) λ Xis +AAV ECFP +AAV λHalf Bit BBa_I11060 : BBa_I11020 BBa_I11033 BBa_B0025 BBa_I11032 BBa_I11021 BBa_E0024 [1] Differ slightly from design as described. Pulse 1a: P22 expressed, no signal, flip bit 2 to make terminator and L, R sites. Pulse 2a: alpha intergrase expressed, no signal, flip bit 1 to make no terminator and L, R sites. Pulse 1b: express p22 int and xis, yfp, flip bit 2 to make no terminator and P, B sites. Pulse 2b: express alpha int and xis, GFP, flip 1 to make terminator and P, B (back to initial state). [2] Means B*?

12. For testing, why was reporter between flip sites? Ara IPTG Int Xis GFP AttP AttB* Design 4 / Test . Slide 13: Turn green when terminator in reverse position? Ara IPTG Int Xis GFP AttP AttB* Design 3. Doesn’t work. 1. Can’t read through attP. 2. Cloning problem in Int construct. 3. Overlaps (between attP & end of Int, and beginning of Int & end of Xis).

13. Construct to test inversion “Description has that system will green when terminator is in the reverse position,” though this not clearly depicted. PLlacO PLtetO Xis Int T0 origin Inverting lambda and GFP? Why? Kan GFP_AAV attB* attP Not designed? p22 attP Reverse Terminator p22 attB (rev comp) ECFP +AAV

14. Failure analysis Overlap implies cross talk between Int and Xis or binding of wrong region of Int / Xis to site? Cloning problem near PLlacO in lambda construct (SalI) PLlacO PLtetO Xis Int T0 Beginning of Int and end of Xis overlap by 40 amino acids [1] End of Int and attP Overlap [2] origin Kan GFP_AAV attB* attP Can’t read through attP Can’t continue after KanR dh5aZ1 [1] Cross talk? and [2] Non-specific binding?

15. Failure analysis Seems that one clear problem with reading through att site GFP No GFP PLtetO PLtetO attP GFP_AAV GFP_AAV attB*

16. First two designs shown are pretty similar. Reasons for difference not clear. Pulse 1 Int 2 Term X 2 GFP AttR AttL* Pulse 2 Int 1 Term X 1 CFP AttP AttB* For test, extrapolate that 2/3 won’t work : can’t have AttP before reporter Lots of additional points: Reverse AttP and B sites. Mutagenize erroneous AttP site on int to eliminate overlaps? Question : is there enough int? What? How to measure levels of xis and int? Why? Int binding block read-through? Need a new strain? Associated between E. Coli genome attB and construct P site? Consider Gateway system (design 5 informed by this) AttB sites can be read through only if RBS is after AttB1

17. Possible new design PLlacO PLtetR Lambda Int p22 Int p22 attB* Lambda attB* Lambda Xis Switch so that it reads through B* site, rather than attP? p22 Xis Lambda attP GFP_AAV p22 attP Again, why inverting full lambda and GFP? Kan pSC101

18. Concerns remained PLlacO PLtetR Enough integrase? What do they mean by enough? How to measure levels? Why do they need to? Int binding blocks read-thru? • Again, why inverting • full lambda and GFP? • Need for a new strain? • attP integration into host chromosome? Lambda Int p22 Int p22 attB* Lambda attB* Lambda Xis p22 Xis Lambda attP GFP_AAV p22 attP Kan pSC101

19. So, looked into designs used by the Gateway system Gateway [1] uses three methods • Promoter – attB1 – rbs – gene of interest – attB2 • Promoter – rbs – Fusion – attB1 – gene of interest – attB2 • Promoter – attB1 – rbs – gene of interest – attB2 – Fusion [1] http://www.bioresearchonline.com/article.mvc/GATEWAY-Cloning-TechnologyA-Universal-Cloning-0001

20. With this in mind, design shifted slightly. Gateway [1] uses three methods • Promoter – attB1 – rbs – gene of interest – attB2 • Promoter – rbs – Fusion – attB1 – gene of interest – attB2 • Promoter – attB1 – rbs – gene of interest – attB2 – Fusion Lambda Int p22 Int PLlacO PLtetR Xis-attB-GFPjunction. want to make a protein across the junction Lambda attB* Lambda Xis p22 attB* p22 Xis Lambda attP GFP_AAV GFP-attP-terminator We want the attP and a transcriptional terminator to follow the GFP p22 attP pSC101 Kan

21. First two designs shown are pretty similar. Reasons for difference not clear. Int 1 X 1 GFP Term AttB* AttP Design 4: Xis-attB-GFP junction (make a protein across the junction) and GFP-attP-terminator PLtetO rbs xis attB rbs gfp attP* t0 rbs int* Design 5: Put int in same operon as GFP What was done with overlaps? Is there enough int? Was this built (what about the Blue Heron constructs)? Int binding read-through? What is the right strain? *int58 aa coding region to allow GFP in same operon; why?

22. P22: xis, attB, gfp junction PLtetO rbs xis attB rbs gfp attP* t0 rbs int* F--T--M--S--*--*-- M—R—K—G- --H--D--K--L--I--T--Q--R--I--R--N--A--K--V--V--K--E--A--A--Y--A--*-- ttcatgacaagctaataacgcagcgcattcgtaatgcgaaggtcgttaaggaggcagcctatgcgtaagga attB rbs

23. P22: gfp-attP junction PLtetO rbs xis attB rbs gfp attP* t0 rbs int* A--*--*-- taataatttttggtacttctgtcccaaatatgtcccacagtaaaaataaggaaggcacgaataatacgt\ Aagtatttgatttaactggtgccgataataggagacgaacctacgaccttcgcattacgaattataagaact\ accttttaagtcaacaacataccacgtcatacctgcgctcacacgtcccatcttcgaaagacatgcaaagcc\ ttgcaaaccgatgcaaagatttgtatgtcccatttttgtcccaaaccacttag Terminator ggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacg\ ctctcctgagtaggacaaatccgcc

24. Lamba bit: xis, attB, gfp junction rbs PLtetO rbs l xis l attB1 gfp l attP1’ t0 rbs int* K--A--K--S--*--*-- M—R—K—G- -R--R--S--H—N—N—K—F—V—Q—K—S—R—L—R—R—Q—A--Y—A--* AAGGCGAAGTCAtaataACAAGTTTGTACAAAAAAGCAGGCTaaggaggcaggcctatgcgtaagga attB1 rbs

25. Lambda: gfp-attP junction rbs PLtetO rbs l xis l attB1 gfp l attP1’ t0 rbs int* A--*--*-- taataacatagtgactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaatt\ Taatatattgatatttatatcattttacgtttctcgttca(gcttttttgtacaaacttg)gcattataaaaaa\ gcattgctcatcaatttgttgcaacgaacaggtcactatcagtcaaaataaaatcattattt Terminator ggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgct\ ctcctgagtaggacaaatccgcc