1 / 27

M 3/31 EXAM II Chapters 8-12, parts of 2, 3

M 3/31 EXAM II Chapters 8-12, parts of 2, 3 W 4/2 Transcription and Translation Chapters 4, 15 M 4/7 "Molecular" Genetics Chapter 16 W 4/9 "Classical" Genetics Chapter 13 M 4/14 Regulation of Gene Expression Chapter 18 W 4/16 DNA Replication Chapter 14

sweeny
Download Presentation

M 3/31 EXAM II Chapters 8-12, parts of 2, 3

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. M 3/31 EXAM II Chapters 8-12, parts of 2, 3 • W 4/2 Transcription and Translation Chapters 4, 15 • M 4/7 "Molecular" Genetics Chapter 16 • W 4/9 "Classical" Genetics Chapter 13 • M 4/14 Regulation of Gene Expression Chapter 18 • W 4/16 DNA Replication Chapter 14 • M 4/21 Genomics and Proteomics Chapter 20 • W 4/23 EXAM III Chapters 4,13-16,18 • M 4/28 Molecular Development Chapter 22 • W 4/30 Molecular Development • Cumulative Final Exam: Wednesday, May 7th, 10:45-12:45, room 303 Payson-Smith Jabberwocky `Twas brillig, and the slithy toves Did gyre and gimble in the wabe: All mimsy were the borogoves, And the mome raths outgrabe.

  2. 1) All living things are composed of cells* • 2) All cells come from pre-existing cells* • * The Cell Theory • 3) All cells exist in a water environment 4) All cells are bounded by a membrane • 5) All cells have similar chemistrys (proteins, proteins, proteins) 6) DNA is the primary heritable molecule (DNA’s BIG job is to code for proteins) • 7) The concept of gene regulation and totipotency

  3. TRANSCRIPTION TRANSLATION

  4. The genotype is the plan (blueprint) for creating an organism. For example, your genotype is the entire genetic information you inherited from your mom and your dad. The phenotype is the output / result of using the genotype plan. The whole organism is the “phenotype”, but we typically focus on a specific gene and refer to a specific phenotype for that gene (like the color of your hair color, for example).

  5. DNA is the primary heritable molecule for all cells. The genotype is the information stored in the DNA. Genotype information is stored just like words in a book: It is physical – You can point to a word in a book and cut out with a scissors. It is linear – books are organized as a long line of letters that are read one after the other It has letters – there are four letters (nucleotides) in the DNA language: A,G,C, and T It is organized into clusters of information – the line of letters in a book is organized into units of information called words, DNA information is broken up into units of information called genes. 5) Just like a word, a gene has more meaning than just a series of letters.

  6. Chapter 4 introduces the chemical structure of DNA and RNA Chapter 15 sort of introduces the concept of the gene.

  7. DNA replication is covered in Chapter 14. We’ll talk about it in a couple of weeks.

  8. The DNA is also (unzipped, denatured, melted) during gene transcription. Transcription is covered in chapters 16 and 18. We’ll talk about it in a couple of weeks.

  9. Symbol 3-letter Meaning Codons ------ -------- ------- ------ A Ala Alanine GCT,GCC,GCA,GCG C Cys Cysteine TGT,TGC D Asp Aspartic GAT,GAC E Glu Glutamic GAA,GAG F Phe Phenylalanine TTT,TTC G Gly Glycine GGT,GGC,GGA,GGG H His Histidine CAT,CAC I Ile Isoleucine ATT,ATC,ATA K Lys Lysine AAA,AAG L Leu Leucine TTG,TTA,CTT,CTC,CTA,CTG M Met Methionine ATG N Asn Asparagine AAT,AAC P Pro Proline CCT,CCC,CCA,CCG Q Gln Glutamine CAA,CAG R Arg Arginine CGT,CGC,CGA,CGG,AGA,AGG S Ser Serine TCT,TCC,TCA,TCG,AGT,AGC T Thr Threonine ACT,ACC,ACA,ACG V Val Valine GTT,GTC,GTA,GTG W Trp Tryptophan TGG Y Tyr Tyrosine TAT, TAC * STOP Terminator TAA,TAG,TGA

  10. This is what genetic information looks like in a chromosome. • ACCAGTGCATCGATCGATTTCGATCGATGCATGCCGCGATCGATGCATGCCGCGCGATCTAGG • In this artificial example, there are four “genes” shown but they are hard to spot • because we don’t know the language. We can change the letters to our alphabet: • ADFTHEBCRDFOURTHNDSFOXLLVSSECONDOPSQUICKIIIFIRSTTOTHESTHIRDXZAPBROWN • The genes are organized in a line just like words in a book but the words are still • hard to spot because the spaces between words are filled with random letters. • ADFTKEBCRDFOURTHNDSFOXLLVSSECONDOPSQUICKIIIFIRSTTPTHESTHIRDXZAPBROWN • Also, the words are not in the correct order for the story. The promoter is a part • of each gene that tells what order the words are used in the story. The promoter • tells where, when, and how much transcription should be done. • ADFTHEBCRDFOURTHNDSFOXLLVSSECONDOPSQUICKIIIFIRSTTOTHESTHIRDXZAPBROWN • So the words get read out in the proper order: • ADFTHEBCRDFOURTHNDSFOXLLVSSECONDOPSQUICKIIIFIRSTTOTHESTHIRDXZAPBROWN • THE QUICK BROWN FOX • Genes that code for proteins that have related jobs, like the LDL receptor and LDL • protein for example, aren’t located next to each other on the chromosome. Their • position on the chromosomes doesn’t matter because the promoters control when, • where, and how much to make.

  11. transcription unit - the part of a gene that gets copied (transcribed) by RNA polymerase coding region – For genes that make (encode) proteins, the coding region is part of the transcription unit. The coding region is the genetic information in the DNA that tells the specific structure (primary amino acid sequence) of the protein to be made. The aquaporin protein has a specific structure due to the primary amino acid sequence and the specific structure of a protein gives each protein a specific function. Again, the coding region provides the information for the primary acid sequence of the protein to be made. promoter – the genetic information in the DNA that tells where, when, and how much the gene should be expressed.

  12. You inherited one copy of each of your genes from your mom and one from your dad. The genes from your mom and dad are similar but not identical.

  13. 30/60 = 50 +10 = 60 30 is the number of questions you got right. 60 is the total number of questions. 50 is your percentage out of 100 10 is the points you got for your notes (10 points maximum). 60 is your total score and is circled. Compare that with what other students got.

  14. 100 98 96 * 94 92 * 90 * 88 *** 86 * 84 * 82 ** 80 ** 78 76 *** 74 ** 72 ** 70 ***** 68 66 ** 64 *** 62 * MEAN = 63 60 *** 58 56 54 ** 52 * 50 ** 48 * 46 * 44 ***** 42 *** 40 * 38 36 **

  15. 100 98 96 * 94 92 * 90 * 88 *** 86 * 84 * 82 ** 80 ** 78 76 *** 74 ** 72 ** 70 ***** 68 66 ** 64 *** 62 * MEAN = 63 60 *** 58 56 54 ** 52 * 50 ** 48 * 46 * 44 ***** 42 *** 40 * 38 36 ** A _____ A- _____ B+ _____ B _____ C+ _____ C _____ C- _____ D+ _____ D _____ D- _____ F

More Related