1 / 17

Overview

Analyzing nuclear and mitochondrial genetic diversity in the Alaska Blackfish ( Dallia pectoralis ).  Rachel DeWilde  University of Alaska Fairbanks  EPSCoR All-Hands Meeting 2011. Overview. The Alaska Blackfish Genetic Analysis Sequencing Mitochondrial DNA

tameka
Download Presentation

Overview

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Analyzing nuclear and mitochondrial genetic diversity in the Alaska Blackfish (Dallia pectoralis) Rachel DeWilde University of Alaska Fairbanks EPSCoR All-Hands Meeting 2011

  2. Overview • The Alaska Blackfish • Genetic Analysis • Sequencing Mitochondrial DNA • Microsatellites • Genotyping Microsatellites • 454 sequencing • Developing primer candidates

  3. The Alaska Blackfish Fresh water fish Poor swimmers Short life span Prefer shallow vegetated habitats

  4. Geographic Barriers • Brooks range • Yukon River • Tanana River

  5. Collection Localities North Slope: 2 Interior: 4 Coast: 8 Russia: 3 =17 Sampling sites 24 24 sampling locations

  6. Interior Coast Russia North Slope Sequencing mtDNA Coast Naknek: 10 Galena: 17 Galena Coast

  7. Microsatellites AGTA CCGTACTGAGCGTACTGAG AGTAGTAGTAGTAGT ACGGCAAATCGTATATTCGA GCG Biparentally inherited Mutation rate Saturate the genome

  8. ACACAC AC ACACACACDinucleotideACACACACACACACA ACGACG ACG ACGACGACG Trinucleotide ACGACGACGACGA GTACGT ACGT ACGTACGTTetranucleotideACGTACGTACG

  9. Genotyping Microsatellites Dinucleotide differences: North Slope & Russia 1 repeat North Slope & Interior 3 repeats North Slope & Galena 5 repeats [at most]

  10. Developing Microsatellites Using 454 Sequencing Initial study: 2009 13 polymorphic microsatellite loci 7,000 microsatellites -66% -33% =10-100 microsatellites

  11. Primer Design Process 1. Extract DNA from one individual 2. Check DNA quality 3. Export to facility 4. Filter sequence results 1. Fresh Fairbanks Fish 2. Nanodrop 3. Duke genome sequencing and analysis facility 4. Msatcommander

  12. Duke Results • 123,109 microsatellites Msatcommander search

  13. 6 repeats 12 repeats 247 microsatellites 62 primers 27 candidate primers 65 Microsatellites 10 primers 5 candidate primers

  14. 27 six repeat primer candidatesand5 twelve repeat primer candidates

  15. Interior North Slope N Interior North Slope Coast Galena Interior North Slope Coast Galena N 12x trial L CLC8X B74AX B2BSZ Interior North Slope Coast Galena N BWBSP B2BSZ CGIUZ Coast Galena N Interior North Slope Coast Galena N L

  16. Future Research Galena sequencing 6 repeat microsatellites 12 repeat microsatellites Candidate primer genotyping

  17. Hosted by: the Lopez lab • MathewCampbell • Mentor • Andres Lopez • Advisor Acknowledgements Funded by: EPSCoR Partial funding from: • The Center for Research Services • INBRE IDea Network for Biomedical Research Questions

More Related