1 / 32

What are Microsatellites?

What are Microsatellites?. D2S123. TAGGCCA CACACACACACACA. Unique Primer. • Mono, di, tri, tetra nucleotide repeats • HNPCC - Expansion/contraction of nl repeats. Strand Slippage. D2S123. 14 bp. TAGGCCA CACACACACACACA. 13-15 BP. 4-40 RPTS. Unique Primer. 12 bp.

tanyafloyd
Download Presentation

What are Microsatellites?

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. What are Microsatellites? D2S123 TAGGCCACACACACACACACA Unique Primer • Mono, di, tri, tetra nucleotide repeats • HNPCC - Expansion/contraction of nl repeats

  2. Strand Slippage D2S123 14 bp TAGGCCACACACACACACACA 13-15 BP 4-40 RPTS Unique Primer 12 bp TAGGCCACACACACACACACA

  3. Mis-Match Repair Genes • hMSH2 • hMLH1 • PMS1 • PMS2 • hMSH3 • hMSH6

  4. Click for larger picture

  5. Click for larger picture

  6. Risk of CRC in ClinicalHNPCC Families: Netherlands Sporadic HNPCC Age 44 69 Location pr: 53% pr: 32% ds: 41% ds: 68% CI35 10% .07% CI50 24% .5% CI75 42% 5.3% Voskuil, Int J CA 1997;72:205

  7. Risk of CRC in MSH2/MLH1HNPCC Families: Netherlands % CRC Lifetime 80 Women 83 Men 92 Endometrial 50 Vasen, Gastro 1996;110:1020

  8. HNPCC • ~ 90% of tumors show MI • Germline defect in MMR genes • 2nd Hit - Somatic Mutation

  9. MSI in Sporadic CRC • 10 - 15% of sporadic CRC • In HNPCC: Germline + somatic = MSI • Sporadic - biallelic somatic mutation via methylation of MLH1 promoter

  10. TC = Transcription Complex Click for larger picture

  11. Gene Testing for hMLH1 or hMSH2 • DGGE • SSCP • IVSP • Direct Sequencing

  12. Gene Testing Cost ($) Sensitivity Sequencing >90% 800 - 3,000 CSGE & Sequencing >90% 1500 Screening (SSCP) 95 - 100% 800 Screening (PTT) 50 - 60% 750 MSI NA 300 Gastro 2001;121:195

  13. Gene Testing for MSH2/MLH1 509 Finnish CRC pts • 5/10 Founder mutation • 7/10 Amsterdam Criteria • All either young, had fam hx, or previous CA 63 MSI 10 (2%) MMR mutations Aaltonen, NEJM 1998;38:1481

  14. Predictive Model for MMR Gene Testing 184 Kindreds: 26% w/ MMR mutations 1) Mean age at diagnosis of affecteds 2) At least 1 member w/ Endometrial CA 3) Amsterdam Criteria Wijnen, NEJM 1998;339:511

  15. Predictive Model for MMR Gene Testing Logistic Model Prob <20% Prob >20% MMR Analysis MSI - + MMR Analysis Nothing Wijnen, NEJM 1998;339:511

  16. Bethesda Criteria and MMR Mutation N=125, “high risk”, Frankfurt, GE Total + BC - BC N 58 (46%) 67 (54%) 125 MSI 17 (29%) 5 (7.5%) 22 (18%) MMR Mutation 11 (65%) 0 (0%) 11 (9%) B1 - B4 46 (79%) Raedle, Ann Int Med 2001;135:566

  17. Bethesda vs. Amsterdam MMR Mutation MSI status Criteria to predict MSI Spec Sens Amsterdam 6/6 27 94 Amsterdam II 8/10 46 90 Bethesda 11/17 77 60 Raedle, Ann Int Med 2001;135:566

  18. Cost Effectiveness of MSI • Decision tree using MSI (Bethesda guidelines) and MMR mutations • 90% CI for cost-effectiveness of screening patients with cancer & relatives: $4,874 - 21,576 / life year gained • Sensitivity analysis - prevalence HNPCC mutation #1 factor Ramsey, Ann Int Med 2001;135:577

  19. Click for larger picture

  20. Mutations in HNPCC Kindreds • 32 Kindreds (N=38) in Buffalo and Vermont • Amsterdam Criteria 25% Incidence of Mutations MSH2/MLH1: Conclusion: • Molecular basis unknown for many subjects Weber, Cancer Res 1997;57:3798

  21. Effectiveness of Screening in HNPCC • 252 subjects, 22 Families (119 Control, 133 screen) • Colon q3yrs, 1984, 15 yr F/U • Not randomized - declined participation Screen Control OR P CRC 8 (6%) 19 (16%) .4 .01 Mutation + 18% 41% .4 .02 Deaths to CRC 0 8% <.001 Jarvinen, Gastro 2000;118

  22. Click for larger picture

  23. Risk of Metachronous CRC

  24. Colonoscopy in High Risk Individuals 31 HNPCC Families - 232 Individuals 86 (38.6%) underwent colonos-compared to controls Case Control P CA 5 1 Adenomas 29 11 .03 TV/V (#) 11 1 Ad Diam 9.1 5.8 .02 HGD (#) 9 3 Ponz de Leon, CEBP 1998;7:639

  25. Center for Families at Risk for CRC Jan ‘98 - June ‘00 Goal: To develop a registry of high risk families To assemble blood/DNA for research Recruitment: Physician referral, Media, UPCI CA Registry High Risk Definition: Young onset, FDR young onset, Multiple cancers Overall: 83 individuals (76 families)

  26. UPCI Registry 188 Dead Alive 82 106 Agreed 33 26 23 Unavailable Not Interested 11 (5.9%) Young onset cancers - <45, 45-55 Enrolled

  27. High Risk Patients 70 Probands - Complete data, exclude FAP 67.1% High Risk 23 Young Onset (<55) 9 Multiple CA’s 15 Young and Multiple (8 Amsterdam Criteria)

  28. Problems With Center • Lab Support • Integrated Recruitment • Coordinated Approach With Other Cancers

  29. Gene Testing • www.genetests.org • www.nsgc.org

More Related