Atypical Multiple Endocrine Neoplasia cases SCOBEC Training day

1. Atypical Multiple Endocrine Neoplasia casesSCOBEC Training day Melissa Sloman Royal Devon and Exeter Foundation Trust

2. Medullary thyroid carcinoma Hyperparathyroidism Phaeochromocytoma Pancreatic – Gastrinoma, Insulinoma Pituitary – Prolactinoma, Acromegaly Hyperparathyroidism Multiple Endocrine Neoplasia Type 2 Type 1 → Mutations in RET gene → Mutations in MEN1 gene

3. Sporadic: 2/3 tumours (parathyroid, pancreatic, pituitary) Criteria for testing MEN1 screening Familial: 2/3 tumours plus one 1st degree relative with 1/3 tumours • Atypical MEN1: • Two or more MEN1-related tumours • Multiple parathyroid tumours before the age of 30 • Recurrent hyperparathyroidism • Gastrinoma or multiple islet cell tumours • Familial isolated hyperparathyroidism Brandi et al. J Clin Endocrinol Metab. 2001 86(12):5658-71

4. Phaeochromocytoma/ Paragangliomas diagnosis NF1 clinical criteria Bilateral adrenal tumours Family history or syndromic presentation Extra-adrenal or multiple tumours Malignant tumour Apparently sporadic presentation Age <35 years VHL + RET RET + VHL SDHB VHL + SDHB + SDHD SDHD + SDHB + VHL RET/ VHL/ SDHB/ SDHD SDHB + SDHD SDHB + SDHD VHL + SDHD Criteria for testing All cases of medullary thyroid carcinoma RET screening Phaeochromocytoma Working Group, Clin End (2006)

5. Case 1 MEN2 • 71 year old female • Medullary thyroid carcinoma • Non-functioning pancreatic tumour • No family history • Children have normal calcitonin levels (MTC marker) MEN1 RET mutation analysis (whole gene) → no mutation identified Patient does not fit MEN1 criteria →MEN1 mutation analysis ‘to exclude a diagnosis of MEN1’

6. Case 1 Patient heterozygous for a novel missense mutation in exon 2 of the MEN1 gene Alamut T76S (c.226A>T) Polyphen = benign Sift = Tolerated Not reported in the literature Not identified in UK and international labs

7. Case 1 Interim Report: ‘XXXXXX is heterozygous for a novel missense mutation (T76S) in exon 2 of the MEN1 gene. This A>T mutation at nucleotide 226 (c.226A>T) results in the substitution of serine for threonine at codon 76 (p.Thr76Ser). The pathogenicity of this variant is uncertain and a further report will be issued when further information is available.’ Emailed clinician: Offer testing for Loss of Heterozygosity (LOH) if tumour tissue available

8. Case 2 • 78 year old male • Extra adrenal abdominal paraganglioma (cortisol secreting, diagnosed aged 70) • Recurrent duodenal gastric ulcers • Cyst in one kidney • Nodules in thyroid/parathyroid • Father had an ulcer • No other family history RET RET (?MTC/hyperparathyroidism) RET mutation analysis → no mutation identified

9. Phaeochromocytoma/ Paragangliomas diagnosis NF1 clinical criteria Bilateral adrenal tumours Family history or syndromic presentation Extra-adrenal or multiple tumours Malignant tumour Apparently sporadic presentation Age <35 years VHL + RET RET + VHL SDHB VHL + SDHB + SDHD SDHD + SDHB + VHL RET/ VHL/ SDHB/ SDHD SDHB + SDHD SDHB + SDHD VHL + SDHD Case 2 Extra adrenal abdominal paraganglioma (diagnosed aged 70) → Analysis of SDHB, SDHD, and VHL did not identify a mutation

10. Case 2 • 78 year old male • Extra adrenal abdominal paraganglioma (cortisol secreting, diagnosed aged 70) • Recurrent duodenal gastric ulcers • Cyst in one kidney • Nodules in thyroid/parathyroid • Father had an ulcer • No other family history MEN1 (?Gastrinoma) MEN1 (?hyperparathyroidism) MEN1 (?Gastrinoma) Patient does not strictly fit MEN1 criteria →MEN1 mutation analysis ‘to ensure not missing wider MEN condition’

11. Case 2 Patient heterozygous for a novel synonymous variant in exon 8 of the MEN1 gene I360I (c.1380C>T) Not seen in 500 patients tested Not recorded on dbSNP Not reported in the literature Not identified in 4 other UK labs

12. Intron Exon ccctacagagaccccactgctctcacag|CTACAACTAC Case 2 I360I located 30bp from splice acceptor site of intron 7 Polypyrimidine tract is weak as it is interrupted with purines → weak polypyrimidine tracts often require Exonic Splicing enhancers (ESE) to promote splicing  ?I360I affect an ESE

13. Case 2 ESEfinder (v3.0) in Alamut Highlight differences Abolishes ESE which binds SC35

14. Case 2 ?I360I abolish an ESE causing a splicing defect • Further work: • mRNA analysis – only theoretical prediction which would need to be confirmed/refuted • LOH studies on paraganglioma or thyroid/parathyroid nodule if tissue available Reported: Sequencing of the coding region and splice sites of this patient’s MEN1 gene has identified a novel heterozygous synonymous variant (c.1080C>T; p.Ile360Ile) which is of unknown clinical significance. The C nucleotide at position 1080 of the MEN1 gene is conserved across all species. In silico analysis using splicing prediction software (ESE finder 3.0) suggests that c.1080C>T may affect splicing regulation. We recommend that testing for loss of heterozygosity (LOH) at the MEN1 locus is undertaken on paraganglioma or thyroid/parathyroid nodule tissue if available. If LOH is indicated, or if tumour tissue is unavailable, then analysis of mRNA could be performed.