Using mouse genetics to understand human disease

1. Using mouse genetics to understand human disease Mark Daly Whitehead/Pfizer Computational Biology Fellow

2. What we do • Genetics: the study of the inheritance of biological phenotype • Mendel recognized discrete units of inheritance • Theories rediscovered and disputed ca. 1900 • Experiments on mouse coat color proved Mendel correct and generalizable to mammals • We now recognize this inheritance as being carried by variation in DNA

3. Why mice? What do they want with me? • Mammals, much better biological model • Easy to breed, feed, and house • Can acclimatize to human touch • Most important: we can experiment in many ways not possible in humans

4. Mice are close to humans

5. Kerstin Lindblad-Toh Whitehead/MIT Center for Genome Research

6. Mouse sequence reveals great similarity with the human genome Extremely high conservation: 560,000 “anchors” Mouse-Human Comparisonboth genomes 2.5-3 billion bp long > 99% of genes have homologs > 95% of genome “syntenic”

7. Genomes are rearranged copiesof each other Roughly 50% of bases change in the evolutionary time from mouse to human

8. Mouse sequence reveals great similarity with the human genome Extremely high conservation: 560,000 “anchors” Anchors (hundreds of bases with >90% identity) represent areas of evolutionary selection… …but only 30-40% of the highly conserved segments correspond to exons of genes!!!

9. What we can do YIKES!!! • Directed matings • Inbred lines and crosses • Knockouts • Transgenics • Mutagenesis • Nuclear transfer • Control exposure to pathogens, drugs, diet, etc.

10. Type I diabetes (3) Type II diabetes (3) Hyperglycemic (27) Hyperinsulinemic (25) Hypoglycemic (1) Hypoinsulinemic (5) Insulin resistant (30) Impaired insulin processing (7) Impaired wound healing (13) Example: diabetes related miceavailable from The Jackson Labs

11. Inbreeding • Repeated brother-sister mating leads to completely homozygous genome – no variation!

12. Experimental Crosses • Breed two distinct inbred lines • Offspring (F1) are all genetically identical – they each have one copy of each chromosome from each parent • Further crosses involving F1 lead to mice with unique combinations of the two original strains

13. Experimental Cross

14. Experimental Cross: backcross • F1 bred back to one of the parents • Backcross (F1 x RED) offspring: 50% red-red 50% red-blue

15. Experimental Cross: F2 intercross • One F1 bred to another F1 • F2 intercross (F1xF1) offspring: 25% red-red 50% red-blue 25% blue-blue F2

16. F2 Trait mapping 100 200 300

17. Trait mapping Blue trees = tall, Red trees = short In the F2 generation, short trees tend to carry “red” chromosomes where the height genes are located, taller trees tend to carry “blue” chromosomes QTL mapping use statistical methods to find these regions

18. How do we distinguish chromosomes from different strains? • Polymorphic DNA markers such as Single Nucleotide Polymorphisms (SNPs) can be used to distinguish the parental origin of offspring chromosomes ATTCGACGTATTGGCACTTACAGG ATTCGATGTATTGGCACTTACAGG SNP

19. 100 B6 % survival 50 C3H 0 0 100 200 300 Days post infection Example: susceptibility to Tb • C3H mice extremely susceptible to Tb • B6 mice resistant • F1, F2 show intermediate levels of susceptibility

20. B6 100 % survival C3H 50 C3H.B6-sst1 0 0 50 100 150 200 Survival Time One gene location already known • Previous work identified chromosome 1 as carrying a major susceptibility factor • Congenic C3H animals carrying a B6 chromosome 1 segment were bred

21. Congenic and consomic mice • Derived strains of mice in which the homozygous genome of one mouse strain has a chromosome or part of a chromosome substituted from another strain C3H B6 C3H.B6_chr1 Chr 1 Chr 2 Chr 3 Chr 4 Etc.

22. Tb mapping cross F2 intercross: C3H.B6-sst1 - MTB-susceptible, carrying B6 chr 1 resistance B6 - MTB-resistant Trait – survival following MTB infection x B6 C3H.B6-sst1 x F1 … F2 n = 368

23. Results: 3 new gene locations identified!

24. B6-IL12-/- 100 100 100 bb bh hh % survival % survival % survival 50 50 50 0 0 0 0 25 50 75 100 125 150 0 25 50 75 100 125 150 0 100 200 300 Days after infection Days after infection days post infection C57Bl/6J BALB/cBJ Chi square 18.99 Chi square 20.17 Chi square 30.02 B. C. A. df 2 df 1 df 2 B6-Igh6 BALB/c-mMT-/- P value P<0.0001 P value P<0.0001 P value P<0.0001 Gene identified on chromosome 12 At the end of chr 12 – mice inheriting two C3H copies survive significantly longer than those with one or two B6 copies Mice engineered to be missing a critical component of the immune system located in this region are likewise more susceptible, validating that particular gene as involved in Tb susceptibility

27. Mouse History • Modern “house mice” emerged from Asia into the fertile crescent as agriculture was born

28. Mouse history

29. Recent mouse history Fancy mouse breeding - Asia, Europe (last few centuries) Retired schoolteacher Abbie Lathrop collects and breeds these mice Granby, MA – 1900 Castle, Little and others form most commonly used inbred strains from Lathrop stock (1908 on) W.E. Castle C.C. Little

30. Mouse history

31. Mouse history • Asian musculus and European domesticus mice dominate the world but have evolved separately over ~ 1 Million years • Mixing in Abbie Lathrop’s schoolhouse created all our commonly used mice from these two distinct founder groups

33. Genetic Background of the inbred lab mice C57BL/6 musc domest musc C3H domest musc domest { DBA domest cast domest musc Avg segment size ~ 2 Mb

34. Comparing two inbred strains – frequency of differences in 50 kb segments { { <1 SNP/10 kb ~40 SNP/10 kb

35. 20 Mb Finding the genes responsible for biomedical phenotypes C3H (susceptible) B6 (resistant) Traditionally: positional cloning is painful (e.g., generating thousands of mice for fine mapping, breeding congenics) – As a result, countless significant QTLs have been identified in mapping crosses but only a small handful have thusfar resulted in identification of which gene is responsible – the critical information that will advance research into prevention and treatment!

36. 20 Mb Using DNA patterns to find genes C3H (susc.) B6 (res.) Critical Region

37. 20 Mb Using DNA patterns to find genes C3H (susc.) B6 (res.) DBA (susc.) Critical Region

38. Example: mapping of albinism Critical region

39. First genomic region mapped Chr 4 35.7 37.6 37.9 39.4 (Mb)

40. Future Genetic Studies Mapping Expression Pathways Model Systems

41. Thanks to (Whitehead Institute) Claire Wade Andrew Kirby (MIT Genome Center) EJ Kulbokas Mike Zody Eric Lander Kerstin Lindblad-Toh Funding: Whitehead Institute Pfizer, Inc. National Human Genome Research Institute