1 / 20

Quiz (take out a sheet of paper)

Quiz (take out a sheet of paper). What are the 3 parts that make up a nucleotide? Name the 4 bases (Letters are fine). Show which bases bind with each other What is the name of the enzyme that unzips DNA during replication? BONUS

tomasso-davock
Download Presentation

Quiz (take out a sheet of paper)

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Quiz (take out a sheet of paper) • What are the 3 parts that make up a nucleotide? • Name the 4 bases (Letters are fine). Show which bases bind with each other • What is the name of the enzyme that unzips DNA during replication? • BONUS • Early scientists designed experiments to test if ______ or ______ caused transformation.

  2. Presentation outline • RNA and Transcription A. Central Dogma of Molecular Biology B. The Structure of RNA • Transcription • Types of RNA • Role of DNA and RNA Go to Section:

  3. Purpose of DNA • DNA holds the genetic information. • A blueprint for the cell • It tells the cell what to build • The purpose of DNA • DNA codes for the proteins that make up an organism • The other day we talked about replicating (copying) DNA • Today, we talk about the steps to make proteins (building materials) from DNA

  4. Central Dogma of Molecular Biology • DNA • RNA • Protein

  5. But how does DNA store the info? • DNA is made up of nucleotides • Nucleotides consist of: • A phosphate • A sugar (deoxyribose) • A base (A,T,C,G) • How could DNA code for a protein? • Let’s look at the structure of DNA again!

  6. Structure of DNA Nucleotide Hydrogen bonds Sugar-phosphate backbone Key Adenine (A) Thymine (T) Cytosine (C) Guanine (G) Go to Section:

  7. The sequence of bases • The varying sequence of bases is like a code • You can compare it to the alphabet and words • For example, we have 26 letters in the alphabet. If you combine the letters into certain sequences you can get a word with a meaning • Uoy rea unfny • You are funny

  8. The sequence of bases • The same thing can be said about DNA • The sequence (order) of bases determine the type of protein produced • ACTTCGATCGGTCAGTCAGTCAGTTACGAT • Black colored hair

  9. Information, Please • DNA contains the information that a cell needs to carry out all of its functions. In a way, DNA is like the cell’s encyclopedia. Suppose that you go to the library to do research for a science project. You find the information in an encyclopedia. You go to the desk to sign out the book, but the librarian informs you that this book is for reference only and may not be taken out.

  10. Information, Please • Why do you think the library holds some books for reference only? • If you can’t borrow a book, how can you take home the information in it? • All of the parts of a cell are controlled by the information in DNA, yet DNA does not leave the nucleus. How do you think the information in DNA might get from the nucleus to the rest of the cell?

  11. Transcription Adenine (DNA and RNA) Cystosine (DNA and RNA) Guanine(DNA and RNA) Thymine (DNA only) Uracil (RNA only) RNApolymerase DNA RNA Go to Section:

  12. Transcription • DNA cannot exit outside of the nucleus • Instead a copy (message) must be made so it can be sent out • RNA polymerase copies the DNA into RNA (message) • NOTICE: NO “T” in RNA sequence

  13. DNA Double stranded Sugar deoxyribose Consists of bases A,T,C,G Located in the nucleus RNA Single stranded Sugar ribose Consists of bases A,U,C,G Can exit the nucleus into the cytoplasm of the cell Structural differences between DNA and RNA

  14. Messenger RNA Ribosomal RNA Transfer RNA Bringamino acids toribosome Combine with proteins tRNA mRNA Carry instructions rRNA DNA Ribosome Ribosomes Different types of RNA RNA can be also called which functions to also called which functions to also called which functions to from to to make up Go to Section:

  15. The Genetic Code Go to Section:

  16. Review • DNA to DNA - Purpose of DNA replication • To make copies of the DNA for cell division • DNA to RNA – Purpose of transcription • To make a copy of the blueprint that codes for the amino acids (proteins) • RNA to protein – Purpose of translation???

  17. 2 day Classwork (worth 40 points) • Create one an informational poster that shows how transcription and translation work • One side or one half • Transcription • Other side or other half • Translation • Must be in color and provide original diagrams • No more than 4 in a group

  18. Homework • Create a cartoon of transcription • Use at least an 8 panel cartoon to show how transcription works. • Be creative

More Related