1 / 37

DEPARTMENT OF BIOTECHNOLOGY ENGINEERING

DEPARTMENT OF BIOTECHNOLOGY ENGINEERING . Even Semester – 2012 - 2013 . 7 th Sem UNIVERSITY EXAM RESULT- BT (2009 BATCH) - SUBJECT WISE PASS % . S5 BT UNIVERSITY EXAM RESULTS 2010 Batch. 20 students out of 24 have a SGPA of 7 and above . No of students appeared : 20

truly
Download Presentation

DEPARTMENT OF BIOTECHNOLOGY ENGINEERING

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. DEPARTMENT OF BIOTECHNOLOGY ENGINEERING Even Semester – 2012 - 2013

  2. 7thSem UNIVERSITY EXAM RESULT- BT (2009 BATCH) - SUBJECT WISE PASS %

  3. S5 BT UNIVERSITY EXAM RESULTS 2010 Batch 20 students out of 24 have a SGPA of 7 and above

  4. No of students appeared : 20 No of students cleared all paper: 09 Pass Percentage: 45% First place: KRISHNAJA SASEENDAN [8] Second Place: ANJALI V [7.86] Third Place: BHAVYA .V.H, & DELNA MATHEW [7.43] S1 & 2 BT UNIVERSITY EXAM RESULTS 2011 Batch

  5. No of students appeared : 20 No of students cleared all paper: 17 Pass Percentage: 85% First place: KRISHNAJA SASEENDAN [8.89] Second Place: BHAVYA .V.H [8.82] Third Place: ANJALI V [8.71] S3 BT UNIVERSITY EXAM RESULTS 2011 Batch

  6. ManoramaYuva Mastermind 2013 - Dr. Satheesh John memorial Award of Rs.60,000/- PROJECT TITLE : “Electricity from Urine” Mr. RothishRamesh , Ms GopikaKartha and Ms. Neenu Tom Guided by Mrs.Megha .P.M STUDENT PROJECT AWARDS

  7. - Second Prize of Rs 30000/- PROJECT TITLE :“An Effective Approach of Bioelectricity Production From Lignocellulosic Waste” Mr. Seby Antony, Ms SangeethaGopal, Ms Mariya Thomas and Ms Celine Thomas Guided by Rahna K Rathnan NATCON 2013

  8. 7 Projects Selected for the final rounds in Techtop 2013 to be held at Technopark Trivandrum during August- 2013 . One project selected for the final round of Jed-i to be conducted at IISc, Bangalore on June 14th 2013. One Project selected for the final round of the student project competition organized by NRDC under the Dept of Biotechnology, Govt of India. PROJECTS SELECTED FOR FINAL ROUNDS

  9. NATCON 2013 • Mr. Pinto Paul, Ms Feba Jose & Ms Anju Paul, guided by Mrs. PraveenaP. The project was “Effective Utilisation of Poultry Waste”. • Mr. RothishRamesh , Mr. Arjun S Kumar, Ms GopikaKartha and Neenu Tom, guided by Mrs. MeghaP.M.The project was “Electricity from Urine”. STUDENT PROJECT COMPETITIONS PARTICIPATION

  10. Mr. Pinto Paul, Ms Feba Jose & Ms Anju Paul, guided by Mrs. Praveena P . Project --“Effective Utilization of Poultry Waste”. • Mr. RothishRamesh, Mr. Arjun S Kumar, Ms GopikaKartha and Neenu Tom, guided by Mrs. Megha P.M. Project --“Electricity from Urine”. • Mr. RahulUnnikrishnan, Ms Jesin Augustine, Ms SreeshmaHaridas & Ms Moni John guided by Mrs. Maria Cyriac. Project --“Slaughter House Waste Management Coupled with Biofuel Production”. SPECTRUM-2013

  11. Ms SreeshmaHaridas & Ms Moni John-first prize in the Paper presentation in GENSPIRE ’13-- “Phytoremediation of selected heavy metals by Azolla”, guided by Mrs. MariyaIssac. • Ms Jesin Augustine--participated in Paper presentation in GENSPIRE ’13-- “Diagnostic techniques for neurological disorders”, guided by Mrs. Ranimol. • Mr. RahulUnnikrishnan presented a paper in GENSPIRE ’13 -- “Mitochondrial DNA as diagnostic tool”, guided by Mrs. Ranimol. • Ms Celine Thomas and Mr. Seby Antony of S8 BT, guided by Rahna K Rathnan, presented a poster on the topic “Bioplastic from lignocellulosic waste” in 3rd INCOFTECH- 2013. PAPER AND POSTER PRESENTATIONS

  12. Ms. Rahna K Rathnan attended One day International workshop On “Amazing Career Opportunities in Food Sciences”. • Ms. P.Praveena (Asst Professor, BT) attended a workshop on Flow Cytometry in CAReKERALAM,Koratty on 15th February 2013. • Ms Celine Thomas, Ms Mariya Thomas, Ms SangeethaGopal and Mr. Seby Antony of S8 BT attended One day International workshop On “Amazing Career Opportunities in Food Sciences”. WORKSHOPS /TRAINING

  13. On 5th December BEATS arranged an invited talk by Mr. Simson Jose, Executive, Cluster Innovation Center from CARe KERALAM ,KINFRA Park, Koratty. • On 7 Jan 2013 BEATS arranged a motivational talk on “How to excel in one’s profession” by Dr. George Kovoor. Association activities Dec 2012-April 2013

  14. Inauguration by Dr. Ranjan S Karippai TECHNICAL SYMPOSIUM- BIOVISION -2013

  15. Dr. Suma T.B, Scientist, Department of Biotechnology, KFRI, Peechi, delivered a talk on “DNA Bar coding” TALKS DELIVERED • Dr. Gireesh (Scientist, Rubber Research Institute ) on Rubber propagation

  16. Poster and paper presentation

  17. Valedictory function

  18. FACULTY EXCHANGE PROGRAMME

  19. Invited talk by Dr. Viji Mary Varghese, on “Stem Cells & Tissue Engineering”. HOD Biotechnology St. Joseph’s College, Irinjalakuda.

  20. Dr. AmbiliMechoor @ St.Joseph’s College Irinjalakuda Forging Links into Biochemical Pathways

  21. Invited Talk at M R College, TN by Ms. Megha PM Biotechnology for the betterment of society

  22. Water Day – 22nd March 2013

  23. On Feb 9th 2013 BEATS volunteered the Sports & Arts Meet for the differently abled students of Thrissur district organized by the Lion’s Club of Irinjalakuda. SOCIAL SERVICE

  24. KSCSTE “Electricity from Urine” –Mrs. Megha “Complete utilization of poultry waste”-Mrs. Praveena “Waste plastic-Golden fuel”- Mrs. Praveena “An Effective Approach of Bioelectricity Production from Lignocellulosic Waste”-Mrs. Rahna “Production of bioplastic from tamarind and jackfruit seeds”-Mrs. Marria IEI “Electricity from Urine” –Mrs. Megha Applications for student project grants(Sent to agencies)

  25. Amitha Joy, Jubil, C. A, Syama, P. S and RohiniMenon – Journal of Computational Biology and Bioinformatics Research(April 2013). • Rahna. K. Rathnan, AmbiliMechoor, Celine Thomas, Mariya Thomas, SangeethaGopal and Seby Antony -- International Journal of Environmental Sciences. (March 2013). • Smeera Thomas1, J. Grace Nirmala2 and R. T. Narendhirakannan2*. Free Radical Scavenging Activities of Nyctanthes arbor-tristis. L on Adjuvant Induced Arthritis in Rats. -- British Journal of Pharmaceutical Research 3(4): 536-547, 2013 Publications in peer reviewed journals

  26. Faculty in the editorial/reviewer board Ms. Rahna K Rathnan– Carbohydrate Polymers; Elsevier publications (ISSN: 0144-8617) Dr. AmbiliMechoor– IJBB, (ISSN:0975-0959 (Online); 0301-1208 (Print) )  Dr. AmbiliMechoor- Agronomy for Sustainable Development ( Print ISSN: 1774-0746; Online ISSN: 1773-0155) Representation in the world of SCIENCE

  27. GenBank: KC686840.1 • DEFINITION : Penicilliumcitrinum strain SCET3 28S ribosomal RNA gene, partial sequence. ACCESSION KC686840 VERSION KC686840.1 GI:484400121 • TITLE Novel cellulolytic fungi isolated from natural source JOURNAL Unpublished REFERENCE 2 (bases 1 to 543) • AUTHORS : Rathnan,R.K., Antony,S., Thomas,M., Gopal,S., Thomas,C. and Mechoor,A. TITLE Direct Submission JOURNAL Submitted (24-FEB-2013) Department of Biotechnology, Sahrdaya College of Engineering and Technology, Kodakara, Thrissur, Kerala 680684, India • Sequencing Technology :: Sanger dideoxy sequencing • organism="Penicilliumcitrinum" /mol_type="genomic DNA" /strain="SCET3" /db_xref="taxon:5077" rRNA <1..>543 /product="28S ribosomal RNA" /note="D1-D2 region" ORIGIN 1 cggcaagagctcaaatttgaaagctggccccctcggggtccgcattgtaatttgcagagg 61 atgcttcgggaacggcccccatctaagtgccctggaacgggccgtcatagagggtgagaa 121 tcccgtctgggatggggtggccgcgcccgtgtgaagctccttcgacgagtcgagttgttt 181 gggaatgcagctctaattgggtggtaaatttcatctaaagctaaatattggccggagacc 241 gatagcgcacaagtagagtgatcgaaagatgaaaagcactttgaaaagagagttaaacag 301 cacgtgaaattgttgaaagggaagcgcttgcgaccagactcgcccgcggggttcagccgg 361 cactcgtgccggtgtacttccccgcgggcgggccagcgtcggtttgggcggccggtcaaa 421 ggcctctggaaggtaacgcctctcggggcgtcttatagccaggggtgccatgcggcctgc 481 ccggaccgaggaacgcgcttcggctcggacgctggcataatggtcgtaagcgacccgtct 541 tga Penicilliumcitrinum strain SCET3 28s ribosomal RNA gene, partial sequence

  28. Mr. Francis John Ms. AmithaJoy Ms. Maria Cyriac Soaring high………………..

  29. Workshop for faculties - Bioinformatics and Molecular Drug designing - Preliminary work initiated . Had talks with KSSTEC & Kerala Biotech Commission. Application under process • Technical talks by eminent scientists and faculty from esteemed institutions • Some speakers contacted – ( Dates yet to confirm) • Dr. M V Joseph , Former HOD, Biotech Dept, Calicut Uty • Dr. S. Mini , Reader Biochem Dept , Kerala Uty • Dr. AnithaSanthosh , ILA laboratory , Dubai Plans for next (ODD) semester-2013

  30. Add on courses proposed and will be conducted in Biostatistics for the final year students. Proposal for an add on course in Molecular Drug Design. Add on courses

  31. Projects under process to KSSTEC & DBT Both Staff as well as student projects Major Projects Anticancer effects of GarciniaCambogia Design of Bioreactors and fuel production from natural sources Minor Projects Students projects are getting prepared by each faculty for the 5th and 7th Semester Project grants Projects to Agencies

  32. S for S programme T for S programme Good Lab practices Uniform code Campus Language Use of Dept Library Improvement & EFFECTIVENESS NEEDED

  33. Mushroom cultivation

  34. Compost making

  35. 5th June – World Environment day Sep 16th - World Ozone day Oct 4th – World Animal welfare day Oct 18th – Karl Ereky’s birthday (Father of Biotechnology) Dec 1st – World Aids awareness day Relevant programmes planned on these days

  36. THANK YOU

More Related