Today’s Plan: 9/10/09

1. Today’s Plan: 9/10/09 • Bellwork: Portfolio updates (10 mins) • Quiz Corrections (20 mins) • DNA Modeling (45 mins) • Notes (10 mins @end of activities) • Pack/Wrap up (last 5 mins)

2. Today’s Plan: 9/11/09 • Bellwork: Vocabulary quiz (30 mins) • If you finish early, review the answers to the questions on the overhead • Finish DNA Structure, DNA Replication and RNA Activities • Replication/RNA/Transcription Notes • Pack/Wrap-up (last few mins of class)

3. Today’s Plan: 9/14/09 • Bellwork: DNA and Replication Quiz (15 mins) • When you finish your quiz, copy down the chart from the overhead and begin filling it in. • Go over quiz (10 mins) • Transcription activity (20 mins) • Transcription/Translation Notes (30 mins) • Pack/Wrap-up (last few mins of class)

4. Today’s Plan: 915/09 • Bellwork: DNA Drills/Chart Practice (20 mins) • Protein Synthesis activity (30 mins) • Mutation Exercise (30 mins) • Pack/Wrap-up (last few mins of class)

5. DNA structure • Composed of nucleotides (see overhead) • Nucleotides consist of: • phosphate • sugar (deoxyribose) • Nitrogenous base • Adenine • Thymine • Guanine • Cytosine • (A only bonds w/T, and G w/C)

6. Hierarchy of Genetics • Genome (all of the chromosomes a person has) • Chromosomes • Chromatid • Chromatin • Genetic code • Gene • Codon • (this gets progressively smaller as you move down the hierarchy)

7. Replication • Defined as the reproduction of an identical copy of DNA. • Mediated by enzymes • Helicase-breaks hydrogen bonds in DNA • Topoisomerase-un-twists and twists DNA • DNA Polymerase-Enzyme which holds DNA open and allows new nucleotides to bond with it • Ligase-Links any “holes” in the non-contiunous DNA strand • Involves unzipping the DNA strand and filling in nucleotides to bond w/the open strand • See overhead and draw pictures

8. RNA Structure • Composed of nucleotides-similar to DNA • phosphate • sugar (ribose) • Nitrogenous bases • Adenine • Uracil (in place of Thymine) • Guanine • Cytosine • Single-stranded molecule (unlike DNA) • see overhead for pictures

9. Transcription • Like replication, takes place in the nucleus • Makes RNA. Question-Why does the DNA send RNA to carry info and not go itself? • Is used to make RNA from specific genes only (not the whole DNA strand) • Starts at the gene’s promoter site (beginning of the gene) and ends at the termination site (end of the gene) • involves the DNA unzipping at the site of that gene, and RNA nucleotides filling in (mediated by RNA polymerase)

10. Types of RNA • Messenger (mRNA)-carries information from the DNA (it is complimentary to DNA) in the nucleus to the ribosome where proteins are made (this is said to be the blueprint for the proteins) • Transfer (tRNA)-is complimentary to the mRNA, and carries amino acids to the ribosome to be assembled into proteins • Ribosomal (rRNA)-is globular in shape and joins to structural proteins to make ribosomes

11. Translation • mRNA moves to the Ribosome, which holds it so that the tRNA can attach, bringing amino acids close together. • The amino acids can then bond to form the protein chain. • See overheads and draw pictures

12. Genetic Code and Genes • Genetic Code consists of all of the bases of DNA (the backbone is only there for structure) • Genes consist of all of the codons that encode for a specific protein (chain of amino acids) • b/c of gene overlap, start and stop codons are necessary

13. Mutation Exercise • Given this Strand: ATGTTACCGAGATTCTTGTTTTAG, transcribe and translate the message. • Now, change the Strand to: ATGTTACCGAGAATCTTGTTTTAG, find the mutation and find the message. • Now, change the strand to: • ATGTTCACGAGATTCTTGTTTTAG, find the mutation and find the message. • Now, change the Strand to: ATGTTACGAGAATCTTGTTTTAG, find the mutation and find the message.

14. Mutation • Point-where one base is changed. • Frame-shift-where one base is deleted • Inversion-where 2 bases switch places • Any can occur at various places. Where can you think of? • What processes may account for mutation?

15. Regulating Genes • Mostly, transcription takes place when a particular protein is needed • Sometimes, organisms have genes with built-in on/off switches • In Prokaryotes (bacteria), there is an Operon system (lac operon is an example) • Promoter is where the enzymes that do transcription attach to the DNA • Operator is the regulation site (on/off switch) where the Repressor molecule binds to turn off the operator • The genes of the operon follow the operator site • When lactose is present, it binds to the repressor, making it change shape, so it no longer fits the operator any more and the gene is on • In Eukaryotes, there are operons, but in stead of containing multiple genes, they only contain 1 gene

16. Figure 17-7a Repressor present, lactose absent: Repressor binds to DNA. No transcription occurs. The repressor blocks transcription Repressor synthesized DNA lacY lacZ lacl+ Normal lacl gene RNA polymerase bound to promoter (blue DNA)

17. Figure 17-7b Repressor present, lactose present: Lactose binds to repressor, causing it to release from DNA. Transcription occurs (lactose acts as inducer). TRANSCRIPTION BEGINS Permease -Galactosidase mRNA Repressor synthesized lacZ lacl+ lacY Normal lacl gene Lactose-repressor complex RNA polymerase bound to promoter (blue DNA)