230 likes | 301 Views
351 exam review. Max and Jeff 6/4/2014. Celera vs. public: human genome sequencing strategies. Public. Celera. An analogy. =~. An analogy.
E N D
351 exam review Max and Jeff 6/4/2014
Celera vs. public: human genome sequencing strategies Public Celera
An analogy =~
An analogy Call me Ishmael. Some years ago--never mind how long precisely—havinglittle or no money in my purse, and nothing particular to interest me on shore, I thought I would sail about a little and see the watery part of the world. ACTGATAGCGATAGATAGATAGTGATAGTGATGATGAGATAGTCGCGCGCTAGCGGCTAGCTTAGCTATGCTAGACTAACTGATAGCGATAGATAGATAGTGATAGTGATGATGAGATAGTCGCGCGCTAGCGGCTAGCTTAGCTATGCTAGACTA =~
Celera vs. public: human genome sequencing strategies Public Celera Split into chapters “Sequence” whole book Chapter 1. Loomings. Chapter 2. The Carpet-Bag. …. Chapter 135: The Chase.--Third Day.
Celera vs. public: human genome sequencing strategies Public Celera Split into chapters “Sequence” whole book Chapter 1. Loomings. Chapter 2. The Carpet-Bag. …. Chapter 135: The Chase.--Third Day. ‘…“Now”, said Queequeg…’ ‘…“Now”, said Queequeg…’ ‘…Captain Ahab had…’ ‘…Captain Ahab had…’
Celera vs. public: human genome sequencing strategies Public Celera Split into chapters “Sequence” whole book Chapter 1. Loomings. Chapter 2. The Carpet-Bag. …. Chapter 135: The Chase.--Third Day. ‘…“Now”, said Queequeg…’ ‘…“Now”, said Queequeg…’ “Sequence” chapters ‘…Captain Ahab had…’ ‘…Captain Ahab had…’ Chapter 27: ‘…“Now”, said Queequeg…’ Chapter 85: ‘…“Now”, said Queequeg…’ Chapter 17: ‘…Captain Ahab had…’ Chapter 104: ‘…Captain Ahab had…’
Celera vs. public: human genome sequencing strategies Public Celera Split into chapters “Sequence” whole book Chapter 1. Loomings. Chapter 2. The Carpet-Bag. …. Chapter 135: The Chase.--Third Day. ‘…“Now”, said Queequeg…’ ‘…“Now”, said Queequeg…’ “Sequence” chapters ‘…Captain Ahab had…’ ‘…Captain Ahab had…’ Chapter 27: ‘…“Now”, said Queequeg…’ Chapter 85: ‘…“Now”, said Queequeg…’ Chapter 17: ‘…Captain Ahab had…’ Chapter 104: ‘…Captain Ahab had…’ assemble
Celera vs. public • Also: • Political • Business
Sequence reads + contigs reads
Sequence reads + contigs reads 6: AGATTC 1: TTCGG 2: GGTAC 3: TACGA 4: CGATC 5: CGATCG
Sequence reads + contigs reads 6: AGATTC 1: TTCGG 2: GGTAC 3: TACGA 4: CGATC 5: CGATCG (alignment)
Sequence reads + contigs reads 6: AGATTC 1: TTCGG 2: GGTAC 3: TACGA 4: CGATC 5: CGATCG contig AGATTCGGTACGATCG (alignment)
Divergence times Chimps + humans diverged 6.5 million years ago.
Divergence times Chimps + humans diverged 6.5 million years ago. How many years of mutation are in: Branch d. Branch c.
Divergence times Chimps + humans diverged 6.5 million years ago. How many years of mutation are in: Branch d. Branch c. Branches c + a Branches d + c + b
Divergence times Chimps + humans diverged 6.5 million years ago. How many years of mutation are in: Branch d. Branch c. Branches c + a Branches d + c + b If there are 6500 mutations only in chimp, and 5000 mutations that are only in human, how many years ago did new hominin and humans separate?
Divergence times Chimps + humans diverged 6.5 million years ago. If there are 6500 mutations only in chimp, and 5000 mutations that are only in human, how many years ago did new hominin and humans separate?
Beneficial vs. neutral vs. deleterious • ~95% of the genome: junk.
Beneficial vs. neutral vs. deleterious • ~95% of the genome: junk. • ~5% of the genome: useful. • ~1.5% protein-coding • ~3% important for gene regulation (promoters, etc.)
Beneficial vs. neutral vs. deleterious • ~95% of the genome: junk. • ~5% of the genome: useful. • ~1.5% protein-coding • ~3% important for gene regulation (promoters, etc.) WHAT IS THE EFFECT OF MUTATIONS HERE???
Beneficial vs. neutral vs. deleterious • ~95% of the genome: junk. • ~5% of the genome: useful. • ~1.5% protein-coding • ~3% important for gene regulation (promoters, etc.) WHAT IS THE EFFECT OF MUTATIONS HERE???