DNA the molecule of life

1. DNA the molecule of life • The nucleus of every cell of your body contains DNA deoxyribonucleic acid. • DNA is the only molecule known that is capable of replicating itself, thereby permitting cell division. • DNA provides the directions that guide the repair of worn cell parts and the construction of new ones.

2. Read Read pages 642-643, 646-647

4. DNA contains instructions that ensure continuity of life – offspring share structural similarities with those of their parents. However, not all offspring are identical to their parents. Why? New combinations of genes and mutations – a change in the DNA sequence, affect the uniqueness of descendants.

5. Searching for the Chemical of Heredity • Early 1940’s: biologists began to accept hypothesis that genetic material was found within chromosomes - long threads of genetic material found in nucleus of cells.

6. Chromosomes are composed of relatively equal amounts of proteins and nucleic acids. Proteins (histones) - basic units are amino acids - made up of 20 different amino acids which can be arranged to make an almost infinite amount of proteins.

7. Nucleic Acids • basic unit is the nucleotide - Nucleotides are made up of phosphates, sugar molecules and one of four different nitrogen bases: adenine, guanine, cytosine & thymine.

8. At this point in time it was thought that the key to the genetic code lied in the proteins. This hypothesis was logical, but incorrect. • 1950 – A chemist named Rosalind Franklin developed a way of using X-rays to take pictures of the DNA molecule. • Her pictures showed that DNA was shaped like a spiral, or helix.

10. 1953 – James Watson & Francis Crick developed a 3-dimensional model of the DNA molecule. • This model is known as the double helix model and it resembles a twisted ladder. Watson Crick

11. Structure of DNA • The uprights of the DNA “ladder” are composed of phosphates & sugars. a. The bases form the “rungs” of the ladder b. The sugar and phosphate form the “uprights”

12. Did you know? Human DNA is 3 billion base pairs and about 2 m in length.

13. The two purines are adenine and guanine Double ring structures The two pyrimidines are thymine and cytosine Single ring structures Cytosine pairs with guanine Adenine pairs with thymine

14. Nucleotides are complementary. a. A pyrimidine pairs with a purine Thymine with Adenine Cytosine with Guanine b. Bases are held together with relatively weak hydrogen bonds (They can “unzip”…)

15. Structure of DNA

16. Replication of DNA • DNA is the only molecule that is known to be capable of duplicating itself. This process is known as replication. • Replication occurs during interphase of the cell cycle.

17. During replication, the weak hydrogen bonds that hold the nitrogen bases together are broken. The DNA “unzips” itself into two parent strands. The enzyme helicase breaks the hydrogen bonds.

18. DNA helicase - an enzyme that uses ATP to “unzip” the DNA molecule This process is known as the “Semi-conservative Replication Model” – Meselson & Stahl (1958). Each strand of DNA pairs with a complementary “new” strand.

19. This produces two, “half old, half new” strands of DNA. • Each “unzipped” parent strand acts as a template to which “free floating” nucleotides in the cell can attach.

20. Enzymes called DNA polymerase bring these “free floating” nucleotides into the replication fork and pair them with their complimentary bases (A with T; C with G). Where do free floating nucleotides come from? The food we eat. Our body producing proteins. Proteins -> amino acids -> nucleotides.

21. Enzymes called DNA ligase fuse the free nucleotides together by catalyzing the formation of the sugar-phosphate bonds between adjacent nucleotides.

22. Steps for DNA Replication Step 1 – Unzipping and unwinding of DNA molecule. - The enzyme, Helicase, breaks the weak hydrogen bonds between the bases to form two strands

23. Step 2 – Pairing of Nitrogenous Bases - “Free floating” nucleotides bind to the “unzipped” strands of DNA. - DNA polymerase facilitates the insertion of the nucleotides. - 2 new complementary strands formed.

24. Step 3 – Linking of the sugar-phosphate groups - Deoxyribose sugar of one nucleotide combines with a phosphate group of an adjacent nucleotide. - DNA ligase enzyme joins the nucleotides together to form two new DNA strands. - Bases form hydrogen bonds. - Product = 2 identical strands of DNA.

25. Complete Enzyme Function Summary Chart on page 666

26. Important to note: • During the replication process, genetic mistakes (base pair error) can occur but these occurrences are infrequent. • Environmental factors such as hazardous chemicals or radiation are one source of genetic mistakes. • These factors can cause uncomplimentary bases to become paired.

27. Enzymes that act as “proofreaders” run along the DNA looking for genetic mistakes like these. • If a damaged section is detected, it can be repaired by an endonuclease enzyme “snipping” out the error from the DNA sequence, and an enzyme called ligase, that patches the DNA back together.

31. Protein Synthesis What do you know about PROTEINS? • Proteins in our bodies are made up of different combinations of 20 amino acids. • The production of proteins is controlled by genes. • Proteins are chemicals that make up the structure of cells. • Enzymes are a kind of protein catalysts that speed up reactions.

32. The “recipe” for proteins is found in the nucleus of the cell, but proteins are made in the cytoplasm. • The DNA molecules do not leave the nucleus because they are too big.

33. Instead, a messenger molecule, called mRNA, makes a copy of the DNA and takes it to the cytoplasm of the cell so that proteins can be made.

34. The mRNA is a type of RNA (ribonucleic acid) with a structure similar to that of DNA. • RNA is a single helix molecule that contains the sugar ribose.

35. Protein Synthesis is divided into two parts: • Transcription • Translation

36. Transcription • mRNA molecules “transcribe” information from a DNA molecule. • the double stranded DNA molecules in the nucleus start to “unzip” at a point where there is a gene that codes for a particular protein

37. As the double helix uncoils, mRNA nucleotides “floating around” in the nucleus bind to the open DNA bases on one side of the DNA molecule.

38. the mRNA transcript begins to form a long chain. • Once the mRNA has been completely formed, the mRNA moves away from the DNA, and the DNA recoils back into a double helix.

39. The single stranded mRNA molecule is small enough to pass through the nuclear pores and moves into the cytoplasm of the cell

40. Initiation • Transcription starts when the RNA polymerase enzyme binds to a segment of DNA to be transcribed • It binds in front of the gene in a region called the promoter which indicated where the DNA strand should be transcribed. • This is a region with a sequence of A’s and T’s • ACCATAATATTACCGACCTTCG

41. Elongation • Once the RNA polymerase binds to the promoter and opens the double helix, it starts building single stranded mRNA in the 5’ to 3’ direction • Similar to DNA replication, but it does not require a primer and copies only one strand • The transcribed DNA strand is called the template strand • It is complimentary except that in the place of of thymine there is uracil

42. Termination Synthesis of mRNA continues until RNA polymerase reaches the end of the gene Termination sequence is at the end of the gene and signals this stop mRNA and RNA polymerase are released and go transcribe another gene

43. Translation • Translation is the process by which the mRNA strand is “translated” into an amino acid sequence (protein). • The mRNA molecule attaches itself to a ribosome in the cytoplasm located in the rough endoplasmic reticulum.

44. Every three nitrogen bases on an mRNA strand codes for one amino acid. This is called a CODON. Not all codons code for amino acids. There are 4 codes that code for initiator or terminator codons. These are codons that tell protein synthesis to start (AUG) or stop (UAA, UAG, UGA.

45. tRNA - transfer RNA I) Carries amino acids to the mRNA ii) Clover leaf shape

46. when the mRNA initially binds to a ribosome, the ribosome attaches to an initiator codon on the mRNA. TRNA (transfer RNA), picks up amino acids that are circulating within the cytoplasm and shuttles them to the mRNA. Each tRNA molecule has an anti-codon to each mRNA codon. This helps the tRNA find the correct amino acid in the cytoplasm

47. The tRNA “drops off” the amino acid (“taxi”) at the ribosome and goes to search again for more. The ribosome moves another three spaces and the next tRNA molecule binds and “drops off” its amino acid. (The ribosome helps in the binding of mRNA and tRNA molecules). This continues until a terminator codon (“stop” codon) is reached and protein synthesis is complete.

48. Initiation Occurs when an ribosome (carries out protein synthesis) recognizes a specific sequence on the mRNA and binds to it. Ribosomes consist of two subunits (large and small) which bind to mRNA, clamping it between them. It moves along adding new amino acids to the growing polypeptide chain each time it reads a codon

49. Initiation • The start codon is AUG • If it starts reading in the wrong place all the codons will be misread. • tRNA delivers the amino acids during translation • At one end of the tRNA is the anticodon which is complementary to the mRNA, the other end carries the corresponding amino acid

50. Example If mRNA has the codon UAU, the complementary base sequence of the anticodon is AUA, and the tRNA would carry the amino acid tyrosine