150 likes | 295 Views
http://jb.asm.org/cgi/reprint/168/2/815 https://mailattachment.googleusercontent.com/attachment?ui=2&ik=9b75ce087f&view=att&th=13227bdb98e458e3&attid=0.1&disp=inline&realattid=f_gs2du9gm0&safe=1&zw&saduie=AG9B_P_leWPr-VdLhYdbZWPY_RFO&sadet=1315782153334&sads=TsSAnLWFQ0h9ZbkdSe0GS6GHLr0.
E N D
http://jb.asm.org/cgi/reprint/168/2/815 https://mailattachment.googleusercontent.com/attachment?ui=2&ik=9b75ce087f&view=att&th=13227bdb98e458e3&attid=0.1&disp=inline&realattid=f_gs2du9gm0&safe=1&zw&saduie=AG9B_P_leWPr-VdLhYdbZWPY_RFO&sadet=1315782153334&sads=TsSAnLWFQ0h9ZbkdSe0GS6GHLr0
Soil organism. • Gram negative bacteria. • Helps in mineralization of aromatic compounds, biodegradation, bioremediation, enzyme engineering, etc. • Addition of linear DNA to log phase makes it an ideal model organism for complex strain construction in genetic engineering.
One of the function of the Acinetobacter sp. is the degradation of benzoate. • Ben genes convert benzoate to catechol and cat genes are responsible for the conversion of the catechol to kreb’s cycle intermediates.
Catalyzes the first step in a catechol utilization via Beta-ketoadipate pathway. • catA gene when induced with isopropyl thiogalactopyranoside, catechol dioxygenasewas formed in E. coli at twice the level found in fully induced cultures of A. calcoaceticus.
DNA from source organism. • Amplification of desired gene by PCR. • Insertion of gene in T4 vector. • Insertion of T4 into Biobrick vectors with the use of restriction enzymes. • Transformation in E.coli. • Study the expression of desired gene.
Forward primer • 18-GASF 5' atggaagtta aaatattcaa tactcagg 3‘ Reverse primer • 18-GASR 5’ttacaccgctagacgtgg 3’
5' atggaagttaaaatattcaatactcagg ----->>3‘ 5’ atggaagttaaaatattcaatactcaggatgtgcaagattttttacgtgttgcaagcggacttgag aaaggtggcaa tccgcgtgta aagcagatca tccatcgtgt gctttcagat ttatataaag ccattgaaga tttgaatatc acttcagatg aatactgggc aggtgtggca tatttaaatc agctaggtgc caatcaagaa gctggtttac tctcgccagg cttgggtttt gaccattacc tcgatatgcg tatggatgcc gaagatgccg cactaggtat tgaaaatgcg acaccacgta ccattgaagg cccgctatac gtggcaggtg cgcctgaatc ggtaggttat gcgcgcatgg atgacggaag tgatccaaat ggtcataccc tgattctaca tggcacgatc tttgatgcag atggaaaacc tttacccaat gccaaagttg aaatctggca tgccaatacc aaaggctttt attcacactt cgacccaaca ggcgagcagc aggcgttcaa tatgcgccgt agtattatta ccgatgaaaa cggtcagtat cgcgttcgta ccattttgcc tgcgggttat ggttgcccac cagaaggtcc aacgcaacag ttgctgaatc agttgggccg tcatggtaac cgccctgcgc acattcacta ttttgtttct gccgatggac accgcaaact aactacgcaa attaatgtgg ctggcgatcc gtacacctat gacgactttg cttatgcaac ccgtgaaggc ttggtggttg atgcagtgga acacaccgat cctgaagcca ttaaggccaa tgatgttgaa ggcccattcg ctgaaatggt tttcgatcta aaattgacgc gtttggttga tggtgtagat aaccaagttg ttgatcgtccacgtctagcggtgtaa 3‘ 3 ‘<<------ggtgtagatcgtcacatt 5’
The desired gene of interest is inserted into the pGEM vector via pGEM-T vector system by using a standard protocol. • Then the catA gene is ligated. • Now the vector containing the desired gene is introduced into the BioBrick vector, with the help of restriction enzyme EcoRI and SpeI.
BBa_I765007 : Iron and UV promoters. • Bba_K116401: External phosphate sensing promoter. • Bba_K118011: PcstA (Glucose- repressible promoter)
The biobrick vectors are inserted into E.coli cells and are transformed. • The transformed cells are checked for the expression of the desired gene.