An Introduction to Phylogenetics

1. An Introduction to Phylogenetics Anton E. Weisstein > Sequence 1 GAGGTAGTAATTAGATCCGAAA… > Sequence 2 GAGGTAGTAATTAGATCTGAAA… > Sequence 3 GAGGTAGTAATTAGATCTGTCA… Indiana State University March 11-14, 2004

2. Outline I. Overview II. Building and Interpreting Phylogenies III. Evolutionary Inference IV. Specific Applications

3. What is phylogenetics? Phylogenetics is the study of evolutionary relationships. Relationships among species: birds snakes rodents primates crocodiles marsupials lizards

4. crocodiles birds lizards snakes rodents primates marsupials What is phylogenetics? Relationships among species: This is an example of a phylogenetic tree.

5. Rwanda A Ivory Coast Italy Uganda U.S. B U.S. India Rwanda U.K. C Ethiopia Uganda S. Africa Uganda D Netherlands Tanzania Russia Romania G F Taiwan Cameroon Brazil Netherlands What is phylogenetics? Relationships within species: HIV subtypes

6. So what is phylogeneticsgood for? Phylogenetics has direct applications to: • Conservation: test wood, ivory, meat products for poaching • Agriculture: analyze specific differences between cultivars • Forensics: DNA fingerprinting • Medicine: determine specific biochemical function of cancer-causing genes

7. HIV Example 1:Florida dentist case 1990 case: Did a patient’s HIV infection result from an invasive dental procedure performed by an HIV+ dentist?

8. Outline I. Overview II. Building and Interpreting Phylogenies III. Evolutionary Inference IV. Specific Applications

9. Sequence A Sequence B Sequence C Sequence D Sequence E Phylogenetic concepts:Interpreting a Phylogeny Which sequence is most closely related to B? A, because B diverged from A more recently than from any other sequence. Physical position in tree is not meaningful! Only tree structure matters. Time

10. A A A B B ? ? X ? X B = = Root Root ? C ? ? D D C C D Time Phylogenetic concepts:Rooted and Unrooted Trees

11. How Many Trees?

12. Evolutionary trees measure time. Phylograms measure change. sharks seahorses seahorses sharks frogs owls frogs Root Root owls crocodiles crocodiles armadillos 5% change armadillos 50 million years bats bats Tree Types

13. Ultrametricity All tips are an equal distance from the root. Additivity Distance between any two tips equals the total branch length between them. X X a a Y b b e Y e c c d d Root Root a = b + c + d + e XY = a + b + c + d + e Tree Properties In simple scenarios, evolutionary trees are ultrametric and phylograms are additive.

14. X a b Y e c d Root Tree Building Exercise Using the distance matrix given, construct an ultrametric tree. Ultrametricity All tips are an equal distance from the root. a = b + c + d + e

15. Phylogenetic Methods Many different procedures exist. Three of the most popular: Neighbor-joining • Minimizes distance between nearest neighbors Maximum parsimony • Minimizes total evolutionary change Maximum likelihood • Maximizes likelihood of observed data

16. Comparison of Methods

17. Which procedure should we use? Neighbor- joining ? Maximum parsimony Maximum likelihood All that we can! • Each method has its own strengths • Use multiple methods for cross-validation • In some cases, none of the three gives the correct phylogeny!

18. Outline I. Overview II. Building and Interpreting Phylogenies III. Evolutionary Inference IV. Specific Applications

19. +flight worms birds lizards lizards snakes snakes snakes +hair +legs rodents rodents +flight –legs primates bats Homology Homoplasy (Convergence) Homoplasy (Reversal) Phylogenetic concepts:Homology and Homoplasy Homology: identical character due to shared ancestry (evolutionary signal) Homoplasy: identical character due to evolutionary convergence or reversal (evolutionary noise)

20. 2002 2001 2000 2001 2002 Watching the Molecular Clock Mutation occurs as a random (Poisson) process. If mutations accumulate at a constant rate over time and across all branches, the phylogeny is said to obey a molecular clock. % genetic difference

21. 2002 2002 2001 2001 2000 2001 2002 Watching the Molecular Clock Mutation occurs as a random (Poisson) process. If mutations accumulate at a constant rate over time and across all branches, the phylogeny is said to obey a molecular clock. BUT: • Natural selection favors some mutations and eliminates others • Selection varies over time and across lineages % genetic difference

22. Trees are hypotheses about evolutionary history So far, we’ve looked at understanding and formulating these hypotheses. Now, let’s turn our attention to testing them.

23. A A A C B B D D C C B D Tree Testing:Split Decomposition Split decomposition is one method for testing a tree. Under this procedure, we choose exactly four taxa (A, B, C, D) and examine the topologies of all possible unrooted trees. How many such trees are there? Only one of these topologies is right. How can we quantitatively assess the support for each tree?

24. A B if A B A B – + + C D is the right phylogeny! D D C C = 2 Large split indices  Long internal branch  Topology strongly supported Small split indices  Short internal branch  Topology weakly supported Negative split indices  Biologically impossible  Topology probably wrong Tree Testing:Split Decomposition The correct tree should be approximately additive; the others usually will not. For each tree, we calculate split indices that estimate the length of the internal branch:

25. Used to assess the support for individual branches Randomly resample characters, with replacement rat Repeat many times (1000 or more) human How often does a specific branch appear? turtle fruit fly 100 oak 73 duckweed 98 Tree Testing:Bootstrapping

26. Tree Testing:Bootstrapping MacClade Example: Vertebrate evolution

27. Outline I. Overview II. Building and Interpreting Phylogenies III. Evolutionary Inference IV. Specific Applications

28. HIV Example 1:Florida dentist case • 1990 case: Did a patient’s HIV infection result from an invasive dental procedure performed by an HIV+ dentist? • HIV evolves so fast that transmission patterns can be reconstructed from viral sequence (molecular forensics). • Compared viral sequence from the dentist, three of his HIV+ patients, and two HIV+ local controls.

29. Florida dentist case

30. So what do the results mean? • 2 of 3 patients closer to dentist than to local controls. Statistical significance? More powerful analyses? • Do we have enough data to be confident in our conclusions? What additional data would help? • If we determine that the dentist’s virus is linked to those of patients E and G, what are possible interpretations of this pattern? How could we test between them?