690 likes | 858 Views
From Gene to Protein. How Genes Work. Making proteins. Organelles nucleus ribosomes endoplasmic reticulum (ER) Golgi apparatus vesicles. small ribosomal subunit. nuclear pore. mRNA. large ribosomal subunit. cytoplasm. Nucleus & Nucleolus. large subunit. small subunit.
E N D
From Gene to Protein How Genes Work
Making proteins • Organelles • nucleus • ribosomes • endoplasmic reticulum (ER) • Golgi apparatus • vesicles small ribosomal subunit nuclear pore mRNA large ribosomal subunit cytoplasm
large subunit small subunit ribosome Nucleolus • Function • ribosome production • build ribosome subunits from rRNA & proteins • exit through nuclear pores to cytoplasm & combine to form functional ribosomes rRNA & proteins nucleolus
large subunit small subunit 0.08mm Ribosomes Rough ER Smooth ER Ribosomes • Function • protein production • Structure • rRNA & protein • 2 subunits combine
Types of Ribosomes • Freeribosomes • suspended in cytosol • synthesize proteins that function in cytosol • Bound ribosomes • attached to endoplasmic reticulum • synthesize proteins for export or for membranes membrane proteins
TO: TO: TO: TO: endoplasmicreticulum nucleus proteinon its way! DNA RNA vesicle vesicle ribosomes TO: protein finishedprotein Golgi apparatus Making Proteins
TACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTATACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTA What happens in the cellwhen a gene is read? Where are the genes? Where does a gene start?Where does the gene end? How do cells make proteinsfrom DNA? How is one gene read and another one not? How do proteinscreate phenotype?
A B C D E disease disease disease disease Metabolism taught us about genes • Inheritance of metabolic diseases • suggested that genes coded for enzymes • each disease (phenotype) is caused by non-functional gene product • lack of an enzyme • Tay sachs • PKU (phenylketonuria) • albinism Am I just the sum of my proteins? metabolic pathway enzyme 1 enzyme 2 enzyme 3 enzyme 4
PKUphenylketonuria alkaptonuria tyrosinosis albinism cretinism ingested protein digestion phenylalanine phenylalanine hydroxylase melanin tyrosine thyroxine transaminase hydroxyphenylpyruvicacid hydroxyphenylpyruvic acidoxidase homogentisicacid homogentisic acidoxidase maleylacetoaceticacid CO2 & H2O
1 gene – 1 enzyme hypothesis • Beadle & Tatum • Compared mutants of bread mold, Neurospora fungus • created mutations by X-ray treatments • X-rays break DNA • damage a gene • wild type grows on minimal media • sugars + required nutrients allows fungus to synthesize essential amino acids • mutants require added amino acids • each type of mutant lacks a certain enzyme needed to produce a certain amino acid • non-functional enzyme from damaged gene
X rays or ultraviolet light Wild-type Neurospora asexual spores Minimal medium Growth on complete medium spores Select one of the spores Grow on complete medium Test on minimal medium to confirm presence of mutation Minimal media supplemented only with… Choline Pyridoxine Riboflavin Minimal control Nucleic acid Arginine Niacin Inositol Folic acid p-Amino benzoic acid Thiamine Beadle & Tatum create mutations positive control negative control mutation identified experimentals amino acidsupplements
One gene / one enzyme hypothesis • Damage to specific gene, mapped to nutritional mutations gene cluster 1 gene cluster 2 gene cluster 3 chromosome arg-E arg-H arg-G arg-F encoded enzyme enzyme E enzyme F enzyme G enzyme H glutamate ornithine citruline arginine argino- succinate gene thatwas damaged substrate in biochemical pathway
1941 | 1958 Beadle & Tatum one gene : one enzyme hypothesis George Beadle Edward Tatum "for their discovery that genes act by regulating definite chemical events"
The “Central Dogma” • Flow of genetic information in a cell • How do we move information from DNA to proteins? transcription translation RNA DNA protein trait DNA gets all the glory, but proteins do all the work! replication
RNA • ribose sugar • N-bases • uracil instead of thymine • U : A • C : G • single stranded • lots of RNAs • mRNA, tRNA, rRNA, siRNA… transcription DNA RNA
Transcription fromDNA nucleic acid languagetoRNA nucleic acid language
Transcription • Making mRNA • transcribed DNA strand = template strand • untranscribed DNA strand = coding strand • same sequence as RNA • synthesis of complementary RNA strand • transcription bubble • enzyme • RNA polymerase coding strand 3 A G C A T C G T 5 A G A A A C G T T T T C A T C G A C T DNA 3 C T G A A 5 T G G C A U C G U T C unwinding 3 G T A G C A rewinding mRNA template strand RNA polymerase 5 build RNA 53
Bacterial chromosome Transcription in Prokaryotes Transcription mRNA Psssst…no nucleus! Cell membrane Cell wall
Transcription in Prokaryotes • Initiation • RNA polymerase binds to promoter sequence on DNA Role of promoter • Starting point • where to start reading • start of gene • Template strand • which strand to read • Direction on DNA • always read DNA 35 • build RNA 53
Transcription in Prokaryotes • Promoter sequences enzymesubunit RNA polymerase read DNA 35 bacterial DNA Promoter TTGACA TATAAT –35 sequence –10 sequence RNA polymerase molecules bound to bacterial DNA RNA polymerase strong vs. weak promoters
Transcription in Prokaryotes • Elongation • RNA polymerase copies DNA as it unwinds • ~20 base pairs at a time • 300-500 bases in gene • builds RNA 53 • Simple proofreading • 1 error/105 bases • make many mRNAs • mRNA has short life • not worth editing! reads DNA 35
Transcription in Prokaryotes • Termination • RNA polymerase stops at termination sequence RNA GC hairpin turn
Transcription in Eukaryotes Transcription RNA Processing Psssst…DNA can’tleave nucleus! Translation Protein
Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons intron = noncoding (inbetween) sequence exon = coding (expressed) sequence Prokaryote vs. Eukaryote genes intronscome out! eukaryotic DNA
Transcription in Eukaryotes • 3 RNA polymerase enzymes • RNA polymerase 1 • only transcribes rRNA genes • makes ribosomes • RNA polymerase 2 • transcribes genes into mRNA • RNA polymerase 3 • only transcribes tRNA genes • each has a specific promoter sequence it recognizes
Transcription in Eukaryotes • Initiation complex • transcription factors bind to promoter region upstream of gene • suite of proteins which bind to DNA • turn on or off transcription • TATA box binding site • recognition site for transcription factors • transcription factors trigger the binding of RNA polymerase to DNA
intron = noncoding (inbetween) sequence exon = coding (expressed) sequence Post-transcriptional processing • Primary transcript (pre-mRNA) • eukaryotic mRNA needs work after transcription • mRNA processing (making mature mRNA) • mRNA splicing = edit out introns • protect mRNA from enzymes in cytoplasm • add 5 cap • add polyA tail 3' poly-A tail 3' A A A A A mRNA 50-250 A’s 5' cap P P P 5' G ~10,000 bases eukaryotic DNA pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA
1977 | 1993 Discovery of Split genes Richard Roberts Philip Sharp adenovirus CSHL MIT common cold beta-thalassemia
Splicing must be accurate • No room for mistakes! • splicing must be exactly accurate • a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP|
snRNPs snRNA intron exon exon 5' 3' spliceosome 5' 3' lariat 5' 3' exon exon mature mRNA excised intron 5' 3' Whoa! I think we just brokea biological “rule”! Splicing enzymes • snRNPs • small nuclear RNA • proteins • Spliceosome • several snRNPs • recognize splice site sequence • cut & paste No, not smurfs! “snurps”
1982 | 1989 Ribozyme • RNA as ribozyme • some mRNA can even splice itself • RNA as enzyme Sidney Altman Thomas Cech Yale U of Colorado
Translation fromnucleic acid languagetoamino acid language
Bacterial chromosome Translation in Prokaryotes Transcription mRNA Translation Psssst…no nucleus! protein Cell membrane Cell wall
Translation in Prokaryotes • Transcription & translation are simultaneous in bacteria • DNA is in cytoplasm • no mRNA editing • ribosomesread mRNA as it is being transcribed
Translation: prokaryotes vs. eukaryotes • Differences between prokaryotes & eukaryotes • time & physical separation between processes • takes eukaryote ~1 hour from DNA to protein • RNA processing
aa aa ribosome aa aa aa aa aa aa From gene to protein transcription translation DNA mRNA protein mRNA leaves nucleus through nuclear pores proteins synthesized by ribosomes using instructions on mRNA nucleus cytoplasm
TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla protein ? How does mRNA code for proteins? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? 4 ATCG 4 AUCG 20
TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA codon MetArgValAsnAlaCysAla protein ? mRNA codes for proteins in triplets
1960 | 1968 Cracking the code Nirenberg & Khorana • Crick • determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT WHYDIDTHEREDBATEATTHEFATRAT • Nirenberg (47) & Khorana (17) • determined mRNA–amino acid match • added fabricated mRNA to test tube of ribosomes, tRNA & amino acids • created artificial UUUUU… mRNA • found that UUU coded for phenylalanine (phe)
1960 | 1968 Marshall Nirenberg Har Khorana
The code • Code for ALL life! • strongest support for a common origin for all life • Code is redundant • several codons for each amino acid • 3rd base “wobble” Why is thewobble good? • Start codon • AUG • methionine • Stop codons • UGA, UAA, UAG
GCA UAC CAU Met Arg Val How are the codons matched to amino acids? 3 5 TACGCACATTTACGTACGCGG DNA 5 3 AUGCGUGUAAAUGCAUGCGCC mRNA codon 3 5 tRNA aminoacid anti-codon
aa aa ribosome aa aa aa aa aa aa From gene to protein transcription translation DNA mRNA protein nucleus cytoplasm
Transfer RNA structure • “Clover leaf” structure • anticodon on “clover leaf” end • amino acid attached on 3 end
Loading tRNA • Aminoacyl tRNA synthetase • enzyme which bonds amino acid to tRNA • bond requires energy • ATP AMP • energy stored in tRNA-amino acid bond • unstable • so it can release amino acid at ribosome easily Trp C=O Trp Trp C=O H2O OH O OH C=O O activating enzyme tRNATrp A C C mRNA U G G anticodon tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA
Ribosomes • Facilitate coupling of tRNA anticodon to mRNA codon • organelle or enzyme? • Structure • ribosomal RNA (rRNA) & proteins • 2 subunits • large • small E P A
Ribosomes • A site (aminoacyl-tRNA site) • holds tRNA carrying next amino acid to be added to chain • P site (peptidyl-tRNA site) • holds tRNA carrying growing polypeptide chain • E site (exit site) • empty tRNA leaves ribosome from exit site Met C A U 5' G U A 3' E P A