Chapter 10 Nucleic Acids & Protein Synthesis

1. Chapter 10Nucleic Acids & Protein Synthesis Overview Living organisms are constructed from thousands of different proteins. Each protein is constructed by ribosomes according to instructions held in the DNA of every cell.

2. Remember: Structure of DNA • DNA is a double helix • It is made of nucleotides. • There are four different types of nucleotides in DNA, each containing a different one of these nitrogen bases • Adenine (A) • Guanine (G) • Thymine (T) • Cytosine (C

3. Structure of RNA • RNA is a single helix, (although it can twist back on itself) • It is also made of nucleotides, but the four nitrogen bases in RNA are: • Adenine (A) • Guanine (G) • Uracil (U) • Cytosine (C)

4. Types of RNA • Messenger RNA • The type of RNA that carries the genetic protein blueprint from the nucleus to the ribosomes • Transfer RNA • The type of RNA that bonds to amino acid and helps carry them to the ribosome and assemble them in the correct order. • Ribosomal RNA • Structural material that makes up the ribosomes. Stored in the nucleolus of animal cells

5. Replication • DNA molecules can copy their entire structure, ie. Make new copies of themselves • All the information stored in the DNA is copied

6. Protein Synthesis: The four T’s • 1. Transcription • In the nucleus: copying the plans • DNAmRNA • 2. Transport • Between the nucleus and the ribosome • mRNA in transit • 3. Translation • At the Ribosome: The plans are decoded • mRNA  tRNA • 4. Transfer and Protein Synthesis • tRNA + Amino Acid  builds protein chain.

7. Transcription • DNA can also copy short pieces of its code onto RNA molecules. • These RNA copies are called messenger RNA (mRNA for short)

8. Steps of Protein Synthesis 1. Transcription • DNAmRNA (or tRNA or rRNA) 2. Transport: Movement of RNA • mRNAribosomes 3. Transfer of amino acids at the ribosome • tRNA molecules bring amino acids to the ribosome 4. Translation of mRNA into a polypeptide chain • The tRNA molecules line up according to the mRNA template, positioning the amino acids to be joined together

9. TranscriptionDNA transcribed to mRNA Transcription happens in the nucleus

10. Transcription: DNA anticodons to mRNA codons The sequence of DNA anticodons is transcribed as codons in mRNA A  U C  G G  C T  A

11. 2. Transport: Messenger RNA moves from the Nucleus to Ribosomes • The mRNA moves through the ER (endoplasmic reticulum) and the cytoplasm to find a ribosome. • The Ribosome is where protein synthesis occurs.

12. 3. Transfer:(at the ribosome) • Transfer RNA (tRNA) bring amino acids to the ribosome to make the protein (AKA polypeptide chain). • Each tRNA has a specific, 3 nucleotide anticodon sequence exposed.

13. Translation: the tRNAs line up in sequence • Proteins are synthesized based on the sequence of bases in the mRNA • The anticodons on the tRNA must line up with the codons on the mRNA

14. The Genetic Code • The information in the DNA is stored in a special code • The five symbols that make up the alphabet of the genetic code are A.U.C.G. and sometimes T. (corresponding to adenine, uracil, cytosine, guanine and sometimes Thymine) • Each “word” or “codon” consists of three of these symbols. This is why it is sometimes called the “triplet code”

15. UUU CUU AAC GGG AAG Phenylalanine Leucine Lysine Glycine Lysine • A “codon” of the genetic code represents one specific amino acid • An “anticodon” is a codon with the opposite nucleotide bases compared to original codon • AT (DNA) or AU (RNA), CG (Both) • A “gene” is enough codons to specify all the amino acids in a particular protein.

16. The Amino Acids: • Amino Acids are the building blocks of proteins. • There are only 20 different amino acids used to build all the proteins in a human. • Each codon represents a different amino acid. • There are 64 possible codons, so several of them are used for other purposes (start, stop, duplicates). • Proteins start out as polypeptide chains so the term polypeptide is sometimes used as a synonym for protein.

17. The 20 Amino Acids and their codons

18. The 64 Codons and their Amino Acids This table is also in your textbook (page 194) Page 194!

19. DNA Codons and Anticodons • The Codons are usually listed as they occur on mRNA, but DNA and tRNA have codons too, but they are the opposite codons (or anticodons) of the mRNA ones.

20. Page 194! Example: (done together) • A DNA molecule has the following anticodons on part of one chain: TACAGCTTTTCAGATACCCATACT What amino acids do they code for? • Step 1: find the correct codons. • AUG UCG AAA AGU CUA UGG GUA UGA • Step 2: find the Amino Acids (short) • Start Ser- Lys- Ser- Leu- Try- Val- Stop • Answer: the protein would contain: • Serine, lysine, serine, leucine, tryptophan, and valine (in that order!)

21. Example: Now you try it • A DNA molecule has the following anticodons on part of one chain: TACAGCTTTACGGGGACCACT What amino acids do they code for? • Step 1: find the correct codons. • AUG-UCG-AAA-UGC-CCC-UGG-UGA • Step 2: find the Amino Acids (short) • Start-Ser-Lys-Cys-Pro-Try-Stop • Answer: the protein would contain: • serine, lysine, cysteine, proline, and tryptophan (in that order!)

22. DNA and Protein Synthesis Videos • Protein Synthesis (computer animation) • Protein Synthesis (hand made stop motion) • Translation (virtual cell)

23. Protein Synthesis • Lab report (DNA extraction) due ASAP • Reading and assignments • Read pages 185 to 196 • Create a representation of the process of protein synthesis in a way that you can remember (group of diagrams, written description, mind-map, list of main ideas) • Answer questions 1-20 on p198