From Gene to Protein

1. From Gene to Protein How Genes Work

2. Translation fromnucleic acid languagetoamino acid language

3. Remember the “Central Dogma” • Flow of genetic information in a cell • How do we move information from DNA to proteins? transcription translation RNA DNA protein trait Now its time to focus on translation! replication

4. Remember: • The Ribosome is the site of protein synthesis – where proteins are MADE • Proteins are POLYMERS • Proteins are made of AMINO ACID MONOMERS • Therefore, if proteins are going to be made, some thing has to bring amino acids to the “protein factory” AND they need to assemble the amino acids into the correct structure to make the needed protein!

5. DETAIL ON TRANSLATION • The completed and processed mRNA molecule goes to the ribosome to be translated. • The image shows the mRNA coming together with the 2 subunits (large and small) that make up the ribosome. • Remember that this occurs in the cytoplasm (rough ER)

6. But how do we know what amino acid goes where??? • THE GENETIC CODE • Carried by the mRNA from the DNA • Based on the order of the nucleotides

7. The code • Same code is used for ALL life! • strongest support for a common origin for all life • mRNA carries the genetic message from the DNA in the form of codons

8. The Genetic Code • 3 nucleotides are required to code for 1 amino acid • The Triplet Code: • The genetic instructions for a polypeptide chain are written in the DNA as a series of non-overlapping, three-nucleotide words. • There are 64 code “words” in the triplet code. • Each triplet is called a CODON.

9. The Genetic Code • Each different codon codes for a different amino acid • UGG codes for Trp (tryptophan) • Codons are read by the ribosome in the 5’ to 3’ direction

10. The Genetic Code • Special Codons • Start Codon • Always AUG • Codes for amino acid methionine (met) • Tells ribosome where to begin translating • Thus, “met” is always the first amino acid in any polypeptide • Stop Codons • UAA, UAG and UGA • Tell the ribosome to stop translating • Code for NO amino acids

11. One more player…tRNA • Once the mRNA and ribosome have come together, a third molecule is still required to “interpret” the mRNA message. This is tRNA. • The “t” in tRNA stands for transfer • tRNA transfers amino acids to the ribosome. • There are many tRNA floating about in the cytoplasm. • Each of these tRNA molecule is carrying around one of the 20 different amino acids. • A cell keeps up its supply of amino acids either by • Manufacturing them itself • Taking them up from the surrounding solution

12. Transfer RNA structure • “Clover leaf” structure • anticodon on “clover leaf” end • amino acid attached on 3 end

13. tRNA structure • anticodon • This sequence is complementary to one of the different codons on mRNA that code for amino acids and binds to it.

14. Example • If the mRNA codon is UUU, then the tRNA anticodon that will “plug into” this codon is AAA. • Any tRNA molecule with this anticodon (AAA) will always carry the amino acid Phe (phenylalanine) which is what the UUU mRNA codon calls for (see the genetic code chart).

15. Making the polypeptide • As the genetic message is translated, the tRNAs deposit amino acids in the order needed, and the ribosome joins the amino acids into a chain.

16. Loading tRNA w/ correct amino acid • Aminoacyl tRNA synthetase • enzyme which bonds amino acid to tRNA • bond requires energy • ATP  AMP • bond is unstable • so it can release amino acid at ribosome easily Trp C=O Trp Trp C=O H2O OH O OH C=O O activating enzyme tRNATrp A C C mRNA U G G anticodon tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA

17. How do amino acids get hooked to the correct tRNAs? • There is an enzyme called aminoacyl-tRNA synthetase – actually there are 20 versions of this enzyme – one for each of the 20 different amino acids • The active sites of each of these enzymes fits only a specific combination of amino acid and tRNA • Once bound, the synthetase catalyzes the covalent attachment of an amino acid to its appropriate tRNA • This process is driven by ATP.

18. Ribosomes • Facilitate coupling of tRNA anticodon to mRNA codon • organelle or enzyme? • Structure • ribosomal RNA (rRNA) & proteins • 2 subunits • large • small E P A

19. Ribosomes • A site (aminoacyl-tRNA site) – ACTIVE site • holds tRNA carrying next amino acid to be added to chain • P site (peptidyl-tRNA site) – PASSIVE site • holds tRNA carrying growing polypeptide chain • E site (exit site) • empty tRNA leaves ribosome from exit site Met C A U 5' G U A 3' E P A

20. rRNA or Protein – which one makes the ribosome work? • Ribosomes are made of both • rRNA and • protein • rRNA is most responsible for ribosomal structure and function • Ribosome is one big ribozyme • RNA acting as catalyst

21. 3 2 1 Building a polypeptide • Initiation • brings together mRNA, ribosome subunits, initiator tRNA • Elongation • adding amino acids based on codon sequence • Termination • end codon release factor Leu Val Ser Met Met Ala Leu Met Met Leu Leu Trp tRNA C A G C G A C C C A A G A G C U A C C A U A U U A U G A A 5' 5' A A 5' C U U 5' A A G G A G U U G U C U U U G C A C U 3' G G U A A U A A C C mRNA 3' 3' 3' U G G U A A 3' E P A

22. met Translation - Initiation • Components brought together • mRNA • Two ribosomal subunits • tRNA • Bearing the first amino acid of the polypeptide that will be made • Remember this is always “met”

23. Translation - Initiation • mRNA attaches to • small ribosomal subunit and… • tRNA carrying “met” amino acid • Small subunit then moves downstream along the mRNA until it encounters the start codon (AUG) • This establishes the reading frame. • The anticodon of the initiator tRNA (w/ “met”) then hydrogen bonds with the start codon on mRNA

24. Translation - Initiation • After mRNA, tRNA and small subunit unite… • Large ribosomal subunit attaches • This completes the translation initiation complex • Initiation factors • Proteins • Bring all components together • Energy used • GTP • At this point the initiator tRNA is sitting on the P site of the ribosome. • The A site is vacant and waits for the next tRNA to arrive

26. Translocation - Elongation • 3 Parts • Codon Recognition • Peptide Bond Formation • Translocation

27. Translation - Elongation • Codon recognition • Anitcodon of incoming tRNA base pairs with the complementary mRNA sequence which is at the A site of the ribosome

28. Codon recognition

29. Translation - Elongation • Peptide bond formation • Peptide bond is formed between the new amino acid at the A site and the old amino acid that has been waiting at the P site • This step removes the amino acid from the tRNA at the P site and adds it to the amino acid at the A site • Thus the polypeptide chain begins to grow

30. Peptide bond formation

31. Translation - Elongation • Translocation • tRNA moves from the A site to the P site • tRNA at the P site moves to the E site where it is released • mRNA moves along to bring the next codon to the A site.

32. Translocation – Everything shifts over

33. Translation - Termination • Elongation continues until a stop codon is reached • UAA, UAG, UGA • Release factor • Protein • Binds to stop codon at A-site • Causes addition of water instead of amino acid to polypeptide • Releases the polypeptide from the tRNA at the P-site • Remainder of the whole assembly comes apart

34. Polyribosomes • Multiple ribosomes translating the same piece of mRNA

35. Modifications of Polypeptides to make FUNCTIONAL Proteins • During synthesis, polypeptides begin to fold spontaneously • Creates specific shape (conformation) • Structure • Gene determines primary structure • Primary structure determines conformation • Chaperone proteins • May help the protein to fold correctly • Post-translational modifications • Amino acids may be modified, removed • Polypeptide may be cleaved • 2 or more polypeptides may come together (quaternary structure)

37. Destinations: • secretion • nucleus • mitochondria • chloroplasts • cell membrane • cytoplasm • etc… Protein targeting • Signal peptide • address label start of a secretory pathway

38. Multiple Roles of RNA in Cells • mRNA - carries information specifying amino acid sequences of proteins from DNA to ribosomes. • tRNA - translates mRNA codons into amino acids • rRNA - plays catalytic (ribozyme) AND structural roles in ribosomes. • Primary transcript - precursor to mRNA (or rRNA or tRNA), before being processed by splicing, etc. • Small nuclear RNA (snRNA)- plays structural and catalytic roles in spliceosomes. • SRP RNA - component of the SRP that recognizes the signal peptides of polypeptides targeted to ER. • Small nucleolar RNA- aids in process pre-rRNA transcripts for making ribosome subunits in the nucleolus. • Small interferring RNA and microRNA - involved in determining which genes get expressed in a cell.

39. How Come RNA Can Do So Many Different Things? • Because of 3 properties: • RNA can hydrogen bond to other nucleic acids • RNA can assume a specific 3-dimensional shape • These can form hydrogen bonds between bases in different parts of the RNA’s own nucleotide chain • Results in complex folding • RNA has functional groups that allow it to act as a catalyst (ribozymes) • Bottom Line: RNA is much more versatile than DNA

40. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla protein ? How does mRNA code for proteins? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? 4 ATCG 4 AUCG 20

41. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA codon MetArgValAsnAlaCysAla protein ? mRNA codes for proteins in triplets

42. GCA UAC CAU Met Arg Val How are the codons matched to amino acids? 3 5 TACGCACATTTACGTACGCGG DNA 5 3 AUGCGUGUAAAUGCAUGCGCC mRNA codon 3 5 tRNA anti-codon aminoacid

43. aa aa aa aa aa ribosome aa aa aa aa aa aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein trait

44. RNA polymerase DNA Can you tell the story? aminoacids exon intron tRNA pre-mRNA 5' GTP cap mature mRNA aminoacyl tRNAsynthetase poly-A tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome