1 / 9

Drew Endy Stanford Bioengineering The BioBricks Foundation The Presidential Commission for the Study of Bioethical Issue

Overview and Context of the Technology of Synthethic Biology. Drew Endy Stanford Bioengineering The BioBricks Foundation The Presidential Commission for the Study of Bioethical Issues Washington DC 8 July 2010. Life has not now been created from inanimate matter. Mice from dirty

aldona
Download Presentation

Drew Endy Stanford Bioengineering The BioBricks Foundation The Presidential Commission for the Study of Bioethical Issue

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Overview and Context of the Technology of Synthethic Biology Drew Endy Stanford Bioengineering The BioBricks Foundation The Presidential Commission for the Study of Bioethical Issues Washington DC 8 July 2010

  2. Life has not now been created from inanimate matter. Mice from dirty rags & wheat bran

  3. Synthetic living systems, “Decoupled” promulgation over time, Replication with representation, Fashioned selections. Natural living systems, Direct generational descent, Replication with error, Natural selection. Synthetic genomes are a BTD (Big Technical Deal) 3

  4. Big stresses can arise when material and information become interconvertible. - Changes in business and distribution models (ongoing transitions from CDs & DVDs, to MP3s & Internet TV) - Challenges to safety & security frameworks (from control of material, to control of information) - Avoidance of nation state and cultural relations (border controls for DNA sequences on the internet, really?) - Increases in scale and pace (overloading of current practices) 4

  5. From absract information to physical, living DNA designs. 2004: 10,000 bp 2010: 1,000,000 bp DNA Construction = #1 Tech. of 21st Ctry. TAATACGACTCACTATAGGGAGA 2016: 100 million?

  6. ~4 meter gap ~99% Genetic Engineering: <20 kb DNA, ~1 dozen DNA components Genome Synthesis: >8 mb DNA, ~1000+ DNA components?! 400-fold “biointegration gap,” today. (We are relatively bad at putting the molecules of biology back together in useful ways)

  7. Beyond synthetic genomes: We’ll need languages & grammars for writing DNA poetry • if {growing} • call wintergreen() • else • call bananas()

  8. To Have the Chance of Being Ethical,We Must Lead Future Biotech. Tool Revolutions First Gen. Biotech Next Gen. Biotech Adds New Tools Recombinant DNA Polymerase Chain Reaction DNA Sequencing = = Basic “Cut” & “Paste” Amplify & Make Simple Changes Read Out the Genetic Code ...

  9. - We often learn best by tinkering. Today, most of biology remains unknown; we stand to learn more than ever before via a synthetic approach. The Technical Ethics of Synthetic Biology - Freedom of the (DNA) press. There are now no sustained public investments in getting better at building DNA; leverage over the presses can lead to control of content (i.e., what is written). - Institutions & individuals; hackers are community. The tools of synthetic biology make biotechnology, today’s *most* compelling technology, available to many. Do we enable or ostracize a future world of “Do-It-Together” biotechnology? Let’s not overlook many basics (e.g., property rights). - Preparedness and reconciliation. More accidents will happen; more misuses will occur; nature is not a liberal representative democracy; how do we make such truths not intolerable?

More Related