1 / 41

L-Proline, D- Glucose and the intracellular cycle of Trypanosoma cruzi

L-Proline, D- Glucose and the intracellular cycle of Trypanosoma cruzi. Laboratório de Bioquímica de Parasitas - Depto. de Bioquímica. Instituto de Química - USP. Vertebrate host. Trypomastigote. Intracellular epimastigote. Epimastigote. Amastigote. Metacyclic trypomastigote.

alesia
Download Presentation

L-Proline, D- Glucose and the intracellular cycle of Trypanosoma cruzi

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. L-Proline, D- Glucose and the intracellular cycle of Trypanosoma cruzi Laboratório de Bioquímica de Parasitas - Depto. de Bioquímica. Instituto de Química - USP

  2. Vertebrate host Trypomastigote Intracellular epimastigote Epimastigote Amastigote Metacyclic trypomastigote Invertebrate host

  3. Why to study L-Proline in T. cruzi ? • Because it is a main carbon and energy source, together with glucose, aspartic acid and glutamic acid. • Because it is involved in the differentiation process from the epimastigote to the trypomastigote forms (metacyclogenesis).

  4. Our goals 1. To study the relevance of D-Glucose and L-Proline in the intracellular cycle of Trypanosoma cruzi. 2. To characterise the transport of L-Proline and D-Glucose among the different stages of the life cycle of T. cruzi.

  5. Experimental infection model • Description: • Cells: CHO-K1 (auxotrophic for L-proline) • Parasites: Trypomastigotes, CL strain clone 14 • This model allows: • The possibility of modulating the intracellular concentration of proline • The possibility of obtaining synchronic cultures

  6. Trypomastigote bursting x [L-proline] Trypomastigotes x 106 mL-1 Days Post infection

  7. Different time post-infection x intracellular stages

  8. Scheme of experiment 200 mM L-Proline 200 mM L-Proline 0 mM L-Proline 0 mM L-Proline 200 mM L-Proline

  9. Trypomastigote bursting x L-Proline in different intracellular stages Epimastigote Amastigote + + - + Trypomastigotes x 106 mL-1 - - + - + 0,2 mM L-Proline - 0 mM L-Proline Days Post infection

  10. Intracellular stages x [L-Proline] Amastigotes Intracellular epimastigotes Trypomastigotes Intracellular forms (106 mL-1) [L-Proline] (mM)

  11. L-proline uptake x substrate concentration Transporte de L-Prolina System A Vo (nmols / 20 x 106 cells min) System B [L-Proline] (mM)

  12. Proline uptake x T. cruzi mammalian host stages Trypomastigotes Amastigotes Intracellular epimastigotes Vm (nmols / 20 x 106 cells min) [L-Proline] (mM)

  13. Intracellular concentration of free proline in different stages [Pro] (mM) ± Intracellular Amastigote 6,61 0,01 ± Intracellular Epimastigote 0,73 0,01 ± Trypomastigote 2,74 0,01 ± Extracellular Epimastigote 6,76 0,04 ± CHO-K1 0,27 0,03

  14. Proline uptake in the different environment where T. cruzi lives Transporte de L-Prolina Insect vector intestinal content LIT 10% FCS Vo (nmols / 20 x 106 cells min) Human serum LIT CHO Cytoplasm [L-Proline] (mM)

  15. D-Glucose uptake x life cycle stages of T. cruzi

  16. L-Proline, D-Glucose and the intracellular cycle: a model

  17. Conclusions • We established that in our model proline is a differentiation factor in the intracellular cell cycle of T. cruzi. • We propose that proline in the extracellular medium (host-cell cytoplasm) is required as an energy source for the intracellular differentiation from the intracellular epimastigote to the trypomastigote stages. • We propose a metabolic switch along the mammalian-host cycle between glucose and proline comsumption, controled by the glucose and proline transporters.

  18. Identification, cloning and functional characterization of amino acid transporters of Trypanosoma cruzi.

  19. Background The metabolism of amino acids is relevant along the parasite life cycle (metacyclogenesis, differentiation inside the mammalian host-cells). The metabolite transporters of T. cruzi are proteins basically unexplored from a molecular point of view. In fact, the single transporter gene that has been cloned up to now, and which function was biochemically demonstrated is the hexose transporter. No amino acid transporters were cloned and functionally characterized in trypanosomes up to date.

  20. Goals 1. To identify genes coding for amino acid transporters (with particular interest for those coding for Proline, Gluatamate and Aspartate) in trypanosomatids. 2. To characterize the products of these genes from a biochemical, molecular and functional point of view.

  21. Algorithm used for the detection of genes coding for putative amino acid transporters

  22. PATs identified in T. cruzi

  23. Alignment of PATs corresponding to group 1 as an example

  24. Analysis of copy number per group and tandem repeats

  25. Analysis in sillico of the presence of trans-membrane spanners Determinantion of the number of putative trans-membrane helices

  26. Phenogram corresponding to the PATs herein described as well as to other amino acid transporters from other protozoans

  27. Confirmation that the PATs correspond to real and expressed sequences PCR from genomic DNA and RT-PCR from total RNA from infective and non-infective stages.

  28. Conclusions (in brief): • Aproximately 1.120.000 sequences corresponding to ESTs and genomic sequences were analysed. Fifteen thousand sequences corresponded to partial ORFs coding for putative amino acid transporters (PATs) . • We could identify 60 ORFs corresponding to PATs. • All the identified genes match with the AAAP family in the classification of the TC • The genes coding for PATs are arranged in tandem repeats in the T. cruzi genome.

  29. Acknowledgements: Dr. Maria Júlia Manso Alves Dr. Walter Colli Dra. Silvia Uliana Dr. Claudio Pereira Lic. León Bouvier Dr. Renata Rosito Tonelli Marcela Martinelli Camila Galvão Lopes Support:

  30. Proline as carbon and energy source Scheme of the intermediary metabolism in trypanosomatids

  31. Modelos de transportadores Uniport Simport Substrato Ion Substrato ATP Ion ADP Antiport Uniport Substrato ATP Substrato Ion ATP ADP Ion ADP

  32. Proline uptake x two intracellular prolin concentrations

  33. Vmax for proline uptake x cations (Na+, K+ or cholin).

  34. L-proline uptake x Temperature

  35. Aminoácido competidor Sistema “A” Sistema “B” % inibição % inibição - 0 0 L-Prolina 77  3 60 ± 5 D-Prolina 17  6 0 Hidroxiprolina 62 +/+- 9 54 ± 10 Ac. Glutâmico 31 ± 7 0 Ac. Aspártico 24 ± 8 0 Glutamina 0 0 Asparagina 3 ± 7 12 ± 9 Alanina 79 ± 11 48 ± 10 Arginina 15 ± 9 0 Cisteína 63 ± 12 64 ± 10 Glicina 46 ± 6 27 ± 10 Metionina 67 ± 6 13 ± 4 Serina 34 ± 12 12 ± 10 Treonina 0 0 Valina 39 ± 11 56 ± 5 Leucina 51 ± 11 23 ± 12 Isoleucina 32 ± 9 0 Fenilalanina 13 ± 7 0 Histidina 0 0 Lisina 0 0 Triptofano 73 ± 7 0 Inhibition of proline uptake by competitors

  36. Proline uptake x pH System A System B Vm (nmols / 20 x 106 cells min)

  37. Proline uptake x Ionophors and other mitochondrial inhibitors System A System B

  38. Northern Blot x life cycle stages of T. cruzi Seqüência da região codificante de transportador de glicose de T. cruzi 1 atgccatcca agaagcagac tgatgtgagt gttggggaca ggcagcccga cgagactctc 61 acattttgct cgttggagaa cctgaaggtt gcacaagtgc aggtggttgg tggaacactg 121 aacggattct caattggctt tgttgccgtg tatgcttatt tctacctgat gtccacggac 181 tgctcgatgt acaagaagga ggtggcgtgc aacagggtat tgaacgcgga gtgttcttgg 241 aacaaaacac gtggagaatg cggctggaac ggctttacct gctttttggg gcacggtaag 301 gataagacgc catgtttgga tgatagcagg tgcaagtggg tgtacagcga cgaagagtgc 361 aagaatccga ctgggtacag ctcgtcctat aacggcatct ttgctggtgc gatgattgtt 421 ggcgcaatga ttgggtcgat ctatgccggg cagtttgccg cgaggtttgg tcacaaggtg 481 tcgttcctga tcgtcggcat cgttggcgtt gtgtcatccg tgatgtacca tgtgtcctcg 541 gcaacgaatgagttttgggt gctgtgcgtt ggtcgtctac tgataggtgt tgtgctcggt 601 cttgtgaacg ttgcatgccc catgtatgtc gaccagaacg cccacccgaa gttccttcac 661 gtggacggtg ttctgtttca ggtgttcacc acgtttggca ttatgtttgc tgcagcgatg 721 gggttggcta ttgggcaaag cgtcaacttt gacaaggaca tcaaaatgga tgcccgcatg 781 cagggctact gtgccttttc tacgctgttg tcggtgctca tggttgcgct tggtatcttc 841 ttgggcgaga gcaagacgaa gtttacgagc ggcaagcacg aggacgatggcactgcgctg 901 gacccgaacg agtacagcta cttgcagatg cttggacctt tggcgatggg actagtgact 961 tccgggacgc tgcaactgac tggcatcaat gccgtgatga attacgcgcc aaagattatg 1021 ggcaacttgg ggatggtgcc tcttgtgggc aacttcgtgg tgatggcgtg gaactttgtg 1081 acaactctcg tctcgattcc acttgcccgg gtcctcacaa tgcgccagct gtttcttggt 1141 gcctcgcttg tggcgtcggt ctcgtgtctg ctcctgtgcg gggtccctgt gtaccccggc 1201 gttgccgata agaacgtgaa gaatggcgtt gcgatcactg gaattgccgt attcatcgcc 1261 gcgtttgaga ttggccttgg accgtgcttc tttgtgcttg cccaggagct gttcccacgc 1321 tctttccgtc cgaggggttc gtccttcgtg ctcttgacga atttcatctt taatgttatc 1381 atcaacgtct gctacccaat cgcgacggag ggcatctctg gcggcccgtc tggcaaccag 1441 gacaagggtc aggcagtcgc gttcatcttt tttggctgca ttggtcttgt ctgcttcgtt 1501 ctgcaggtgt tcttcctgta cccgtgggag gagagcactc ctcagaacca cggagacacc 1561 aacgaagagt ccgcacttcc agaacggcag tcgccgattg aggttgccac ccctggcaac 1621 cgtcaagccg cgtga Northern Blot: a: epimastigota; b: tripomastigota; c: amastigota a b c 2.7 kpb - 2.1 kpb -

  39. Algoritmo proposto para a identificação e caracterização de PATs

More Related