1 / 104

The Pines October 28, 2013

Genomic Medicine. Malcolm Campbell James G. Martin Genomics Program Director Professor of Biology, Davidson College. The Pines October 28, 2013. Outline of Talk. What is a genome? How to sequence genomes? Diagnose and Treat Cancers Better? New Drugs from Failures: Iressa

alexa
Download Presentation

The Pines October 28, 2013

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Genomic Medicine Malcolm Campbell James G. Martin Genomics Program Director Professor of Biology, Davidson College The Pines October 28, 2013

  2. Outline of Talk What is a genome? How to sequence genomes? Diagnose and Treat Cancers Better? New Drugs from Failures: Iressa New Treatment Paradigms Gut microbiome

  3. Science Presentation Give you the data, help you interpret.

  4. What is a Genome?

  5. Genetic information that you unique Human genome 3.4 billion base pairs G:C or A:T base pairs ~23,000 genes What is a Genome?

  6. If the human genome were compiled in books: 200 volumes, 1000 pages each read 10 bases/second = 315,360,000 bases/year 9.5 years to read out loud (without stopping) What is the Human Genome?

  7. Determine order of bases on all 23 (24) chromosomes Can only read 30 to 700 bases at a time Cannot sequence a genome in one run “Whole Genome Shotgun” sequencing How do you sequence a genome?

  8. Determine order of bases on all 23 (24) chromosomes Can only read 30 to 700 bases at a time Cannot sequence a genome in one run “Whole Genome Shotgun” sequencing How do you sequence a genome?

  9. Modern Genome Sequencing

  10. Modern Genome Sequencing This is an analogy for genome assembly. This page will be torn into horizontal strips.

  11. Modern Genome Sequencing This i s an is an

  12. Modern Genome Sequencing This i s an is a

  13. Modern Genome Sequencing This is an analogy for genome assembly. This page will be torn into horizontal strips. This i s an is a

  14. You don’t know the language or syntax. This i s an is a

  15. Huge Pile of Strips This i s an is a

  16. Needle in a Haystack? This i s an is a

  17. Reassemble the Tree from Paper

  18. Modern Genome Sequence Assembly multiple copies of genome aligned sequencing reads consensus genome sequence

  19. Modern Genome Sequence Assembly multiple copies of genome aligned sequencing reads consensus genome sequence

  20. Modern Genome Sequence Assembly multiple copies of genome aligned sequencing reads high coverage low coverage consensus genome sequence

  21. Modern Genome Sequence Assembly multiple copies of genome aligned sequencing reads consensus genome sequence

  22. Reference Genome Assembly ATGGCATTGCAA TGGCATTGCAATTTG AGATGGTATTG GATGGCATTGCAA GCATTGCAATTTGAC ATGGCATTGCAATTT AGATGGTATTGCAATTTG

  23. Reference Genome Assembly ATGGCATTGCAA TGGCATTGCAATTTG AGATGGTATTG GATGGCATTGCAA GCATTGCAATTTGAC ATGGCATTGCAATTT AGATGGTATTGCAATTTG AGATGGCATTGCAATTTGAC consensus

  24. How do I remember them all? 206 bones > 60 organs

  25. Think like a genomicist… 206 bones > 60 organs

  26. 1 – 22 + X & Y

  27. Even Easier GCAT

  28. Is there a better way to diagnose and treat cancers?

  29. Is there a better way to diagnose and treat cancers? Diffuse Large B Cell Lymphoma (DLBCL)

  30. Diffuse Large B Cell Lymphoma (DLBCL) 25,000 new cases each year in America Half of patients die despite chemotherapy Why subject them to chemo if not helpful?

  31. Who will benefit from chemotherapy? Brown and Botstein

  32. Who will benefit from chemotherapy? patient and control biopsies control set

  33. Measure Gene Activity in All Cells

  34. Characterize Cancers by Gene Activity

  35. Retrospective Clinical Outcomes based on gene activity

  36. Retrospective Clinical Outcomes based on gene activity traditional prediction

  37. Retrospective Clinical Outcomes wrong 27% wrong 32%

  38. Retrospective Clinical Outcomes wrong 37%

  39. Resort Low Risk Patients wrong 37% wrong 29%

  40. Six Key Indicator Genes Genes On Genes On LMO2 BCL6 FN1 BCL2 SCYA3 CCND2 chemo no chemo

  41. Can Breast Cancer Treatment Be Improved?

  42. Can Breast Cancer Treatment Be Improved? tissue biopsies

  43. Can Breast Cancer Treatment Be Improved?

  44. No Patterns Emerged control set patient biopsies

  45. People Are More Unique Than Their Cancers before (BE) and after (AF) chemotherapy

  46. Characterize Cancers by Personal Differences

  47. Characterize Cancers by Personal Differences

  48. “Breast Cancer” is a Misnomer

  49. There are at least 5 Different Breast Cancers

  50. No such thing as THE cure for cancer.

More Related