1 / 26

Carbon meets Silicon (& the $1000 human genome) Oct 9, 2002 HBS

Carbon meets Silicon (& the $1000 human genome) Oct 9, 2002 HBS. gggatttagc tcagttggg agagcgcca gactgaa ga t ttg gag g tcctgtgtt cgatccac agaattc gcacca. Post- 300 genomes & 3D structures. 6. Commericial Advisory Roles & Technology-transfer.

anakin
Download Presentation

Carbon meets Silicon (& the $1000 human genome) Oct 9, 2002 HBS

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Carbon meets Silicon (& the $1000 human genome) Oct 9, 2002 HBS

  2. gggatttagctcagttgggagagcgccagactgaa gat ttg gag gtcctgtgttcgatccacagaattcgcacca Post- 300 genomes & 3D structures 6

  3. Commericial Advisory Roles & Technology-transfer Genome Pharmaceuticals  98-02 Caliper Technologies  94-02 CodonCode 96-02 GenProfileAG 97-02 Gendaq 00-1 EngeneOS 00-2 BeyondGenomics 00-2 Newcogen & Flagship 00-2 Longenity 01-2Xeotron 01-02 Genomatica 01-2 Genome Therapeutics 89-94; Biogen 84-5 Tecan/Gamera 98-00 FamilyGenetix 00-1; Biorad-Sadtler 79-81 Affymetrix 90-02Millipore 89-90 Lynx  00-02Pyrosequencing 01-2 Bruker Daltonics 93-7 Mosaic Technologies   93-01 Agilent 01-2 Aventis ‘98-01 MJ Research Inc. 86-02 Hamilton Co. 86-90 Intelligent Automation 92-6 Eli Lilly 98 Dupont 82-4 This page was last updated 17-May-2002 by GMC.

  4. Famous human mutations PKU (preventable mental retardation) HbS (Malaria resistance) ApoE4 (dementia resistance) CCR5D32 (HIV resistance)

  5. Pharmacogenomics Gene/Enzyme Drug Quantitative effect Examples of clinically relevant genetic polymorphisms influencing drug metabolism and effects. Additional data

  6. 2-Oct-2002 Boston GSAC Panel Discussion"The Future of Sequencing Technology: Advancing Toward the $1,000 Genome" • Moderators: • J. Craig Venter, Ph.D., The Center for Advancement of Genomics • Gerald Rubin, Ph.D., Howard Hughes Medical Institute • Speakers: • George Church, Ph.D., Harvard University • Eugene Chen, Ph.D., US Genomics • Tony Smith, Ph.D., Solexa • Trevor Hawkins, Ph.D., Amersham Biosciences Corporation • Susan Hardin, Ph.D., VisiGen Biotechnologies, Inc. • Michael P. Weiner, 454 Corporation • Daniel H. Densham, Mobious Genomics, Ltd

  7. The impact of new technologies Digital computers & Networks 1968-93 WWW 1993-94 Recombinant DNA 1976-1986 Genome Project 1985-2002 Stem cells 1983-2002 Nanotechnology 1984-2002

  8. Bionano-machines Types of biomodels. Discrete, e.g. conversion stoichiometry Rates/probabilities of interactions Modules vs “extensively coupled networks” Maniatis & Reed Nature 416, 499 - 506 (2002)

  9. Steeper than exponential growth Moore's law of ICs 1965 http://www.faughnan.com/poverty.html http://www.kurzweilai.net/meme/frame.html?main=/articles/art0184.html

  10. How to do single DNA molecule manipulations?

  11. Important alleles occur in “noncoding” non-conserved regions Lesch KP, et al Science 274:1527-31 Association of anxiety-related traits with a polymorphism in the serotonin transporter gene regulatory region Piedrafita FJ, et al. JBC 271: 14412 Alu repeat SNP near the human Myeloperoxidase gene: “severalfold less transcriptional activity” "-463 G creates a stronger SP1 binding site ... overrepresented in acute promyelocytic leukemia"

  12. Why low-cost, high quality sequencing? & how much? Human genotypes 1019bp Immune B&T cell receptor spectra 1010bp (per year) Environment & pathogen monitoring ? RNA splicing in situ : 1012 bits/mm3 Compact storage 105 now to 1017 bits/ mm3 with DNA & How? The issue is not speed, but hidden costs (e.g. accuracy & integration) Sub-microliter scale: 1mm = femtoliter (10-15) Instruments <$100K per CPU.

  13. Projected costs greatly affect our priorities bp/$ $/genome Method 1977 0.1 30B manual (pBR322) 1985 1 3B HGP goal 2002 10 300M de novo high-quality sequencing 2002 300 10M dd-polyphred raw-reseq 2002 2K 2M Perlegen, Lynx 2002 3M 1K per diploid? de novo? This session! 2002 1013 .0003 other data types (e.g. video)

  14. New sequencing approaches in commercial R&D Method liter/bp Length Error Test-set $/device bp/hr Capil mfluidics e-6 600 <0.1% 1e11 350k 80k ABI, Amersham, GenoMEMS, Caliper*, RTS* SeqByHyb e-12 1 <5% 1e9 200k 1M Perlegen-Affymetrix*, Xeotron* Mass Spectrometry Sequenom, Bruker* Single molecule >e-24 >>40 ? >80 30k-1M 180k Pore(Agilent*) Fluor(USGenomics, Solexa) FRET(VisiGen,Mobious) In vitro DNA-Amplification (e.g. Polonies) -- Multiplex cycles: Lynx* e-15 20 <3% 1e7 ? 1M Pyroseq.* e-6 >40 <1% 1e6 100k 5k CisTran* e-13 >35 <1% 40 90k >1M? ParAllele, 454, RTS* *GMC has a potential financial interest (or Harvard license)

  15. $1K per diploid human sequence Input: buccal cells, blood, or forensic samples. Output: prioritized list of deviant bps (e.g. non-conservative). Raw data rate: 16 pixels/bp, 1Mpixel per 6sec/CPU = 24 CPU days. Amortization: 5 yr for camera/CPU/transport @ $50K total = $200 per 1011 bp Overhead: $200 /sq ft/yr * 40 sq.ft (400 cu.ft) = $40 Reagents: At 20 mm per (5 mm) polony and 40 bp reads means 10000 cm2 area, 800 ml of fluor dNTP, $100/mg = $40 5 ml PCR reactions = $200 Disposables: 500 slides = $50 Electricity: 2 kwatts 24hr*24days* 0.13$/kwatt-hr = $150 Labor for repair: 10% of instrument cost = $10 Labor for operation: Slide PCR, slide dips, scans, etc. = $20 R&D: Initially NIH grants (i.e. 0% of this unbalanced budget). Total: per genome $710

  16. Long-range continuity inspired by DNA-Fiber Fluorescent In Situ Hybridization http://allserv.rug.ac.be/~fspelema/neubla/content/images_r.htm 300 kb = 100 microns

  17. Polony amplification & sequencing

  18. Human DNA:Cystic Fibrosis CFTR gene45 kbp Rob Mitra Vincent Butty Jay Shendure Ben Williams David Housman Hitomi Hutzell

  19. Polymerase colony (polony) In situ amplification (PCR, RCA, etc.) B A A A B B B A B B B A A A A B A B B Single Molecule (library or natural A,B tags) A Primer is Extended by Polymerase A Primer A has 5 immobilizing Acrydite Mitra & Church Nucleic Acids Res. 27: e34

  20. Sequence polonies by sequential,fluorescent single-base extensions 3 3 5 5 B B B B A G T C G G T . . . . 1. Remove 1 strand of DNA. 2. Hybridize Universal Primer. 3. Add Red(Cy3) dTTP. 4. Wash; Scan Red Channel

  21. Sequence polonies by sequential, fluorescent single-base extensions B B B B 5. Add Green(FITC) dCTP 6. Wash; Scan Green Channel 3 5 3 5 C G A T C G C G T . . .

  22. Sequencing multiple polonies Base added: (C) A G T (C) Alignment precision 0.4 pixel (A) G (T) C (A) 3 TCACGAGT AGTGCTCA (G) T C A Mitra &Shendure

  23. Polony exclusion principle &Single pixel sequences Mitra & Shendure

  24. Inexpensive, off-the-shelf equipment Histology slide rack MJR in situ cycler Microarray scanner

  25. Polony in situ Sequencing Summary • Integrated!: (purify), amplify, sequence, (separate) • Femtoliter (1mm) scale • Off-the-shelf equipment • Chromosome haplotyping & RNA splice-typing • In situ tissue compatible

  26. Types of phenotypic effects of mutations PKU Trisomy 21 HbS

More Related