1 / 16

Specificity of argonaute protein association with miRNA

Specificity of argonaute protein association with miRNA. Molly Blatz Dr. Jim Carrington Dr. Sunny Gilbert. Importance of small RNA. Gene regulation Growth and development Therapeutics Agriculture. miRNA Functions. miRNA precursor. Dicer. miRNA. RISC proteins.

ayla
Download Presentation

Specificity of argonaute protein association with miRNA

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Specificity of argonaute protein association with miRNA Molly Blatz Dr. Jim Carrington Dr. Sunny Gilbert

  2. Importance of small RNA • Gene regulation • Growth and development • Therapeutics • Agriculture

  3. miRNA Functions miRNA precursor Dicer miRNA RISC proteins (Zamore, Bartel, Sharp, Carrington labs) Translation arrest Target RNA degradation

  4. Background • Small RNA silencing is a mode of gene regulation. • Argonaute proteins are the catalytic components of RISC. • miRNAs guide AGOs to their targets. • The nucleotide at the 5’ end is one source of miRNA specificity.

  5. 5’ nucleotide specificity of AGO’s Kim, N. (2008) Cell Montgomery, et. al. (2008) Cell; Mi et. Al. (2008) Cell; Takeda, et. Al. (2008) Plant Cell Physiology

  6. What We Know • 5’ nucleotide specificity rule has exceptions. • There are miRNA’s that associate with AGO1 and lack 5’U. • AGO7 has no known 5’end nucleotide specificity. • Instead it only binds miR390. • GOAL: Understand the rules of miRNA association with AGO’s.

  7. miRNA Sequence • miRNA’s that deviate from AGO1, 5’U rule contain U at eleventh position. • Hypothesis: A uracil at position 11 is important for association with AGO1. miR172: AGAAUCUUGAUGAUGCUGCAU Binds AGO1 miR172-11G: AGAAUCUUGAGGAUGCUGCAU Binds AGO1 ??? miR390: AAGCUCAGGAGGGAUAGCGCC Binds AGO7 miR390-11U: AAGCUCAGGAUGGAUAGCGCC Binds AGO1 ???

  8. HA-AGO Tissue How Lyse Cells Input Fraction • Construct mutant miRNAs. • Infiltrate Nicotaniabenthamiana with constructs containing miRNAs, tagged proteins, and appropriate controls. • Co-immunoprecipitation • Small RNA gels Immunoprecipitate using HA antibody IP Fraction Small RNA gels Small RNA gels

  9. HA-AGO Tissue Position 11U Results Vector in HA HA-AGO1 in HA HA-AGO7 in HA Lyse Cells Input Fraction Vector miR172-11G associates with AGO1 miR172 Immunoprecipitate using HA antibody miR172-11G IP Fraction Vector in HA HA-AGO1 in HA HA-AGO7 in HA Vector miR390-11U associates with AGO7 and not AGO1 Small RNA gels Small RNA gels miR390 miR390-11U 11U is not a specificity determinant.

  10. Determine how non-5’U miRNAs are specified • Too much background miR390 and miR172 • Make new system using a miRNA that is distinguishable from endogenous miRNA but is still processed efficiently.

  11. Alteration of miR390 • Eliminate competition with other AGOs. • Purine and pyrimidine conservation. • Changed position 19 from a G to C • Choose miRNA over miRNA* • Changed position 1 from an A to a G • 5’ end of miR390 doesn’t play a role in association. miR390: AAGCUCAGGAGGGAUAGCGCC miR390-19C: AAGCUCAGGAGGGAUAGCCCC miR390: AAGCUCAGGAGGGAUAGCGCC miR390-5’G: GAGCUCAGGAGGGAUAGCGCC

  12. Alteration of miR390 • Prediction: Both miR390-5’G and miR390-19C should bind AGO7 and accumulate as well as endogenous miR390.

  13. miR390 Alteration Results miR390-5’G creates a 19 nucleotide small RNA miR390-19C accumulates more

  14. miR390 Alteration Results miR390-5’G associates with AGO7 even though it is a 19 nucleotide small RNA.

  15. Future Plans • Create miR390 with single point mutations at every position. • Test nonconserved miRNAs.

  16. Acknowledgement • Howard Hughes Medical Institute • Dr. Jim Carrington • Dr. Sunny Gilbert • The Carrington Lab

More Related