1 / 45

Lawrence Berkeley National Lab Center for Environmental Biotechnology Todd DeSantis, Sonya Murray, Jordan Moberg, Gary A

Microarrays. Lawrence Berkeley National Lab Center for Environmental Biotechnology Todd DeSantis, Sonya Murray, Jordan Moberg, Gary Andersen. The ponderings of a pre-schooler. Why can’t I watch Shrek 3 times per day?. Will the swings be wet at the park?.

bailey
Download Presentation

Lawrence Berkeley National Lab Center for Environmental Biotechnology Todd DeSantis, Sonya Murray, Jordan Moberg, Gary A

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Microarrays Lawrence Berkeley National Lab Center for Environmental Biotechnology Todd DeSantis, Sonya Murray, Jordan Moberg, Gary Andersen

  2. The ponderings of a pre-schooler Why can’t I watch Shrek 3 times per day? Will the swings be wet at the park? How will this lactose impact the diversity in my lower G.I. bacterial community? Will I inhale any archaeal microorganisms when I visit the hot springs? Microarrays can help answer these types of questions. Will I be as bald as my Dad? Vincent DeSantis

  3. What can they do? • Determine if a particular biological macromolecule is in a complex sample. • Examples of biological macromolecules: • Microarrays can also quantify the abundance.

  4. One-of-a-kind foot • Molecule of interest is identified by some unique feature. • Cinderella is identified by her unique foot. • The foot is the “target” to be sought. • If her foot was common to all women, then would her foot be useful target? • Unique molecular features (targets). • DNA or RNA  sequence of ACGT(U) • Proteins  AA, Epitopes • Lipids ? • Carbohydrates  branch structure

  5. Need a perfect slipper • Molecule of interest (target) must capture, or be captured by, a second molecule (probe). • Many feet had to be evaluated by an easy test. • The specific, not common, glass slipper was used as the test (probe). • Unique molecular probes. • DNA or RNA  DNA or RNA (Oligo nt). • Proteins  Proteins (Antibodies) • Lipids ? • Carbohydrates ? • My focus: DNA targets probed with complementary DNA

  6. DNA Pairing Fundamentals • Adenine (A) pairs with Thymine (T) • Cytosine (C) pairs with Guanine (G) • The two DNA strands are held together by _______ bonds • “Complimentary Strands”

  7. Base-pairing allows DNA:DNAor DNA:RNA

  8. Example application • Do Diabetic patients have lower glycogen synthase levels compared to healthy individuals? • Analyze RNA, determine specific target • 5’...UAUUAGCGCUCGAUCGCUUAGUACAGCGAGGAAAAGUCCGAUAGUAC...3’ • Synthesize DNA probe • 3’ ATCATG 5’ • Attach probe to a surface. • Nylon sheet • Plastic dish • Glass slide • Prepare samples Label all mRNA, expose to probes D+ Extract mRNA from skeletal muscle sample D- • Diabetes 51:1913-1920, 2002Gene Expression Profile in Skeletal Muscle of Type 2 Diabetes and the Effect of Insulin Treatment, Sreekumar, et al.

  9. Hybridization • Notice all mRNA is labeled (florescence) • Non-binding mRNA is washed away • If surface “glows”, then target was captured by probe. • What does it mean if no “glow” is detected? • http://www.affymetrix.com

  10. Example Results Membrane with glycogen synthase probe attached * * * D+ * * * * * * * * * * Labeled mRNA* Wash * * * * * * D- * * * * * * *

  11. Red-Green • http://www.unc.edu

  12. Millions of copies per feature

  13. Photolithography • Affymetrix - Photolithography • Nimblegen – microscopic independent mirrors to direct light.

  14. Coordinates of fluorescence determines test results.

  15. 500,000 Probe 16S array (DOE 16S Chip)

  16. Rapid taxonomic classification of complex consortia of environmental rDNA using a microarray. What “bugs” are in my sample? Environmental Surveys Counter Bio-terrorism Bioremediation Clinical Investigations

  17. Example Microorganisms • C. immitis • B. anthracis • Plus thousands more .... Lung

  18. Project Overview • Goal • Create a single microarray capable of detecting and categorizing the bacteria in a complex sample. • Approach • GeneChip targeted at 16S rDNA sequence variations to distinguish taxa.

  19. The Ribosome rDNA rRNA (functional molecule) LSU SSU 16s or 18s

  20. Foundations: • Maintain the largest 16S gene library (~83,000). • Cluster sequences into taxa (~10,000). • Create algorithm for picking probes for each taxa (~500,000).

  21. Desulfovibrio sp. str. DMB. Desulfovibrio sp. 'Bendigo A' Desulfovibrio vulgaris DSM 644 Sequence discrepancies Regions not unique to taxon Regions unique to taxon Probe set: 02280401041000.2154

  22. General Protocol Run Video Air Soil Feces Blood Water gDNA Universal 16S rDNA PCR rRNA Contains probes adhered to glass surface in grid pattern.

  23. Reproducibility  Probes for C. jejuni tiled in 4 areas

  24. Counter Bio-Terrorism • Sampling the Air • Extracting DNA • Hybridization • PCR • Single Organism Detection • Detection Arrays for Multiple Organisms

  25. Traditional Detection • Collect air sample • Swab sample onto petri dish • Wait 2 days to 4 weeks for organisms to grow • Isolate • Biochemical tests • Visual Inspection

  26. PCR • Polymerase Chain Reaction • Makes many DNA copies from few

  27. Hybridization Occurs Between Complimentary Strands Join properly when cooled Separate when heated

  28. Probes Search for Targets Probes

  29. Probes Search for Targets

  30. G G A A T A C A G G T G C C A T Poly DNA Replication Foundations • DNA Polymerase • enzyme which “xeroxes” a single strand in to a double strand • assembles dNTPs monomers into a polymeric strand • adds dNTPs to 3’ end of polymer

  31. G G A A T A C A G G T G C C A T Poly Polymerase Chain Reaction (PCR) • An in vitro technique for creating many copies of a gene segment • Components • polymerase • template DNA • dNTPs (individual A, C, G, or T) • Small probes called “primers” Let’s do it...

  32. T T A G T G T A G T T C C G A A C T T G C A G T T C C C G G G A A G G A A Polymerase Chain Reaction (PCR) 95° Hot temperature ensures template is single stranded. - 5’ 3’- Single stranded template to be “xeroxed”

  33. T T A G T G T A G T T C C G A A C T T G C A G T T C C C G G G A A G G A A Polymerase Chain Reaction (PCR) 95° Primer designed by lab G C C A A G T - 3’ A T G G 5’- A T G A C A - 5’ 3’-

  34. T T A G T G T A G T T C C G A A C T T G C A G T T C C C G G G A A G G A A Polymerase Chain Reaction (PCR) 55° Lowering temperature allows hydrogen bonding to form G C C A A - 3’ G T A T G G 5’ - A T G A C A 3’ - - 5’

  35. G G A A T A C A G G T G C C A T Poly Polymerase Chain Reaction (PCR) 72° Polymerase can act upon free 3’ end when it has bound to the template. 5’ - A A A - 3’ G A G T G C T T G A A C G T C A G A T T T A G G T 3’ - G C T C G A A C T T G C A G T T C C C - 5’ G G A A G G A A Temperature raised to optimize polymerase activity

  36. G G A A T A C A G G T G C C A T Poly Polymerase Chain Reaction (PCR) 72° Polymerase can act upon free 3’ end when it has bound to the template. 5’ - A A T A C A G A C A A G T G C T T G A A C G T C A G G G - 3’ A T T T A G C C T G T 3’ - G C T T T C C T C G A A C T T G C A G T T C C C - 5’ G G A A G G A A Temperature raised to optimize polymerase activity

  37. career preparation • Do a Senior Project that involves both CS and BIO students • Find Mentor • Interview, Interview, Interview (on campus, off-campus, maintain contacts) • Learn HTML/Perl/Java/CGI

  38. Attractive Perl Properties: • Forgiving syntax • Interpreted, not compiled • Platform independent • Text manipulation • Libraries, modules, etc. • Object oriented optional

  39. Why Perl is the leading language of Bioinformatics? • Perl easy to learn • Perl is powerful • Perl is free • Large support group: www.bioPerl.org • Interfaces easily to relational databases • In fact, it has been claimed that Perl saved the Human Genome Project

  40. Examples: • Find all the genomic 20-mers in common between Vibrio cholera str.14 and Vibrio mimicus • This could take a long time by hand. V.choler14 ...TTGTACACACCGCCCGTCACACCATGGGAGTGGNCTGCAAAAGA-GCAGGTAGTTTAACC... V.mimicus ...TTGTACACACCGCCCGTCACACCATGGGAGTGGGCTGCAAAAGAAGCAGGTAGTTTAACC...

  41. Probe Finding Project • Given: • one microbial taxon • Purpose: • Describe its taxonomic placement. • Find two interesting things about the organisms in that taxa. • Find a probe that is specific for a group of organisms. • Method: • Obtain 16S Sequences. • Align them to each other (MSA) • Determine best target from a short list (provided). • Verify that probe exists in all/most orgs of taxa • Check for X-hybe (non-specificity) • Check w/in sub-division, not all sequences

  42. Start Here

  43. Answers (Targets) • Oceanospirillum • TGCTACTTCGCCGGCGAGCGGCGGA • Streptococcus • CTTGACATCCTTCTGACCGGCCTAG • Rhodococcus • CGGGTCTCTGGGAAACAACTGACGC • TGGGAAACAACTGACGCTGAGGAAC • Methanocorpusculum • TGGAGAATACTCCCGGGAAACTGGG • Desulfovibrio • GCGTGAAAGGACTTCGGTCCGAGTA

  44. Multi Microarray Analysis • Track a bio-marker over many experiments. • Download file • Fluorescence intensity for118 taxa reported for 5 experimental conditions, and a negative control. • Find • Taxa with highest intensity overall. • Possible PCR contaminants • Taxa with greatest intensity fluctuation overall • Condition producing the brightest signal for Paracoccus yeeii?

More Related