Nature, Structure and Organisation of Genetic Material

1. Nature, Structure and Organisation of Genetic Material Unit 4 – Outcome 1 Chapter 10

2. TOPICHistory of the Discovery of Inheritance 10.1 pgs 340- 356

3. 10.1 Key Themes/ Terms pgs 340-356 • Gregor Mendel’s role in discovery patterns of inheritance • History of his discoveries • Mendel’s experimental design • Variety of traits in peas • Mendel’s assumptions (basis of his discoveries) • Mendel’s Principles of Inheruitance: • Theory of Particulate Inheritance • Principle of Segregation of Alleles • Law of Independent Assortment • Thomas Hunt Morgan – location of ‘genes’ • Frederick Griffiths- discovery of chemical nature of genetic material • Oswald Avery: link between chemical material and DNA • Watson & Crick: 3 D structure of DNA

4. 10.1READING/ HOMEWORK TASKS PGS 340-356 Reading: Nature of Biology: pgs 340-356 Quick Check: • Q’s 1-4 p345 • Q’s 5-8 p351 • Q’s 9-11 p353 Biozone • P279: Mendel’s Pea Plant Experiments • P280: Mendel’s Laws of Inheritance

5. GREGOR MENDEL (1822-1884) • Austrian monk with a penchant for breeding • Worked at the Brno monastery (Czech Republic) • Studied inheritable traits with distinct and predictable patterns of inheritance • Presented his findings on his ‘model of inheritance’ in Brno in 1865 • Published his findings (100 copies of his journal distributed) in 1866 • Sent a copy to Carl Niageli in 1866 • Findings ignored for 30 years! • Model rediscovered in 1900 by three biologists (de Vries, Correns and Tschermak) • By end of 1910, Mendelian Principles was universally accepted as a basis of inheritance in plants and animals

6. MENDEL’s EXPERIMENTS Mendel chose to study pea plants because: • other research showed that pea hybrids could be produced • many pea varieties were available • peas are small plants and easy to grow • Pea plants sexually reproduce • peas can self-fertilize or be cross-fertilized • Pea plants have many identifiable traits (see overleaf) • Mendel developed a method that would prevent self fertilization • He carefully removed the stamens from flower buds on one pea and dusted pollen (male gamete) that he collected from another pea plant onto the stigma of the first plant (connected to the Ovary containing female gamete)

8. MENDEL’S METHOD • for eight years (1856-1864) he carried out breeding experiments with varieties of pea plants • Set up crosses between plants that differed in just one trait (initially), such as pod colour. Termed these crosses Monohybrid Crosses. • Set up crosses between plants that differed in two traits (initially), such as pod colour. Termed these crosses DihybridCrosses. • To start his crosses, Mendel only used parents pure breeding for the known traits. (P Generation) • Repeated his experiments recording the phenotype ratios of the offspring of his crosses • His results had validity because of the large number of repeatable crosses he performed

9. MENDEL’S ASSUMPTIONS p343 Mendel’s ‘model of inheritance’ was built on several assumptions: • Each trait was controlled by a pair of inherited factors (alleles!) • Example: Trait for seed colour controlled by pair of factors with one producing ‘yellow’ and the other producing ‘green’ • For each trait, individual plants had two factors that could be either identical or different. Identical factors were referred to as pure breeding (i.e GG or gg) and different factors together called hybrids • Each factor was a discrete particle (allele!) that could be passed on from generation to generation • The character (i.e. green or yellow) that was produced in the F1 genereation (from pure bred parents with different traits (GG * gg) was Dominant while the hidden character was Recessive. • During gamete formation, the memberss of the each pair of factors (Bb) separated to different gametes, one factor per gamete (B, b). This is the Principle of Segregation of Alleles: Mendel’s First Law) • In seperating, members of one pair of Alleles (i.e. Bb) behaved independently of members of other pairs of factors. This is the Principle of Independent Assortment, Mendel’s Second Law • The results of a particular cross were the same regardless of which plant was used as the male or female Quick Check: 1- 4 Page 345 Biozone: pgs 279

10. MENDEL’S LAWS OF INHERITANCE • The Theory of Particulate Inheritance • Characters (i.e brown hair) are determined by discrete units that are inherited down through the generations • Principle (Law) of Segregation • During gamete formation, the members of the each pair of factors (Bb) separated to different gametes, one factor per gamete (B, b). This is the Principle of Segregation of Alleles: Mendel’s Law) • Principle (Law) of Independent Assortment • In separating, members of one pair of Alleles (i.e. Bb) behaved independently of members of other pairs of factors. This is the Principle of Independent Assortment, See Page 347 Text Biozone Page 280

11. FREDERICK GRIFFITH 1877-1941 • His investigations with smooth and rough bacterium led to the discovery of a ‘transforming factor’ in cells • Transforming substance had a chemical nature • Chemical substance was genetic material OSWALD AVERY 1877-1955 • identified the chemical nature of the ‘transforming factor’ (genetic material) • used Griffith’s studies o guide his own • Link established between DNA and genetic material (see Table 10.3) Quick Check p351: 5 - 8

12. NATURE OF GENES Revision: • Nucleotide sub units assembled head to tail forming a chain • Four different kinds of nucleotides in DNA normally distinguished by the letters A, C, G and T • Each contains a sugar (deoxyribose) part, a phosphate part and a N- containing base • Four different bases are: adenine, thymine, cytosine and guanine • DNA heated at 90 degreec C for two minutes dissasociates(DNA molecule separates to form to single strands of DNA nucleotides). When cooled, the chains rejoin (re-association) • Pairing of complimentary DNA chains from different sources is referred to as hybridisation

13. CHARGAFF’S RULE • whilst amount of DNA varies from species to species, the relative amounts of Adenine to Thymine, and Guanine to Cytosine was always the same!

14. WATSON & CRICK (1953 DISCOVERY) • identified the 3 d structure of dna • nucelotides arranged in a double helix • each DNA molecule consists of two nucleotide chains • chains run in opposite directions, said to be ‘anti-parallel’ • phosphate and sugar on the outside of the double helix and coil around each other with a constant diameter • bases arranged so that they point to the inside of the DNA molecule • bases joined by ‘weak’ hydrogen bonds • bases pair through ‘complimentary base pairing’ This complimentary double helix structure for DNA fits with the known properties of the genetic material including the facts that DNA: • can act as a template for its own replication • Contains genetic instructions • Can undergo change or mutation

15. Quick Check – pg353 9-11 pg356 12-14 • Biozone 197 – 199

16. TOPICStructure and Function of Genes 10.2 pgs 356- 383

17. 10.2 Key Themes/ Terms pgs 356- 383 • DNA- Deoxyribose Nucleic Acid (revisited…) • Purines & Pyrimidines • Complimentary base pairing • How much DNA? • Bp (base Pairs) • Gene Sequencing • Nature of Genetic Code: • Universal code, DNA Triplet, mRNA Codon, start codon (Met), Degenerate triplets • Genomics • Genomics, genome, SNPs (single Nucleotide Polymorphisms)

18. 10.2READING/ HOMEWORK TASKS PGS 356-383 Reading: Nature of Biology: pgs 356 - 383 Quick Check: • Q’s 15-17 p362 • Q’s 18-23 p364 • Q’s 24-27 p370 Biozone • Pg 196 DNA Molecules • Pg 201 The Genetic Code • Pg 187 Genomics

19. Revision ..DNA – Deoxyribonucleic Acid • Genes are made of the chemical substance called Deoxyribonucleic Acid (DNA)

20. Revision .. Nucleotide Bases

21. Revision … • The matching nucleotides pair up as follows: • A-T • T-A • C-G • G-C

22. HOW MUCH DNA? • A human cell has an estimated 60000 to 80000 genes. • Genes consist of around 8000 base pairs and up to 2 million base pairs in length. • The distance between each Bp is 0.34 nanometers. • To calculate the length of a gene or DNA strand – simply multiply the number of Bp’s by 0.34nm. GENE SEQUENCING • ATGGTGCACCTGACTCCTGAGGAGAA • What is this? • This is part of the nucleotide sequence of the template strand of the human HBB gene – (produces haemoglobin) • Gene sequencing involves the process of identifying the order of nucleotides along a gene.

23. NATURE OF THE GENETIC CODE • the genetic code in DNA typically contains information for joining amino acids to form proteins. • proteins consist of 20 different amino acid sub units • The genetic instructions of all organisms uses an ‘alphabet’ of four letters only, namely: A, T, C and G. This is why the code is known as Universal • One genetic instruction consists of a group of three (DNA) bases i.e AAT, this is known as a TRIPLET • a triplet (typically) codes for 1 amino acid. • thereare 64 possible triplets and only 20 amino acids. What can you infer from this? • all genes commence with a start triplet (TAC). Tac also codes for the amino acid Met (Methionine) • a TRIPLET is copied by mRNA as a complimentary copy: TAC = AUG • mRNA copies are called Codons • Some codons (three mRNA nucleotides) code for the same amino acid. This is known as Degenerate • Biozone pg 201 The Genetic Code • Quick Check -364 18-23

24. ORGANISATION OF THE GENETIC CODE • Most genetic instructions consist of a group of 3 bases (AAT) called a triplet code. • Like Morse code this form is sufficient to create amino acids to from protein. • Consider the code: TACAAACAAGCTCCTACT • Now break it into its triplet code we now have: TACAAACAAGCTCCTACT • Each triplet code creates a specific amino acid and when combined creates a new protein. TACAAACAAGCTCCTACT • Using table on page 393, the following is encoded as: • TAC – Start (Methionine) • AAA – (Phenylalanine) • CAA – (Valine) • GCT – (Arganine) • CCT – (Glycine) • ATT – Stop

25. GENOMICS • the genome of an organism is its complete set of genetic instructions • The field of study of genomes is termed genomics • when a genome is sequenced, it means that the precise order of sequences in the DNA of the genome has been identified • 1.5% of DNA codes for proteins (exons) • every person (apart from identical siblings) has a unique genome • 3 billion bp (base pairs) organised as a DNA double helix • an average of 3 million differences between individuals (0.1 per cent of total DNA in humans!) • Differences in DNA sequences between individuals are known as single nucleotide polymorphisms (or SNPs) and are a source of variation between organisms • Biozone p187 Genomes • Quick Check pg 370 24-27

26. TOPICBase Mutations; Exons & Introns 10.3 pgs 370 - 383

27. 10.3 Key Themes/ Terms pgs 370- 383

28. 10.3READING/ HOMEWORK TASKS PGS 370-383 Reading: Nature of Biology: pgs 370 - 383 Quick Check: • Q’s 28-29 p373 • Q’s 30-31 p376 Biozone • Pg 262 The effect of Mutations • Pg 263 For harm or benefit • Pg 268 Gene Mutations • Pg 269 Sickle Cell Mutations

29. GENE MUTATIONS • Defn - Gene Mutations: general term for one of many possible changes in the DNA base sequence of a gene • genetic material is usually stable, however a sudden unexpected change may appear. • this change is known as a mutation. • mutations change the instructions that are encoded in genes. • When a causative factor can not be identified , a mutation is said to be a spontaneous mutation (i.e. as a result of errors during DNA replication) • When a causative agent can be identified it is called an induced mutation (caused by Mutagens including radiation, x-rays, certain chemical substances) • Not all mutations are inherited, only those takinh place in those cells producing gametes

30. Mutagens

31. GENE MUTATIONS continued… • Consider the base sequence below: • AAT GTC GGA GTC • Mutations involve changing the sequence and if developed in germline cells – will be transferred to future generations. • Somatic Mutation: Mutations occurring in cells other than sex cells – will not be passed onto the next generation. • Germline Mutation: Mutations occurring in sex cells which will be passed onto future generations. • Biozone p 262 The Effect of Mutations • Biozone p263 For Harm or Benefit

32. SUBSTITUTION MUTATIONS10AAT GTC GGA GTC20 • Substitution: replacement of one nucleotide by another. • AAT CTC GGA GTC • (substitution of G by C at position 13) • usually affects only one amino acid; Some substitution • mutations may not do anything as the change in nucleotide • may still code for the same amino acid. • a mutation that causes no change is called a ‘silent mutation’. • Biozone p269 Sickle Cell Mutation Defn - Frameshift Mutation: type of mutation in which, as a result of insertion or deletion of a base, all codons from that point are affected. Addition: insertion of nucleotide into strand. AAT GTC GGT AGT C Deletion: Removal of nucleotide from the strand. AAT GCG GAG TC FRAMESHIFT MUTATIONS10AAT GTC GGA GTC20

33. TRI-NUCLEOTIDE REPEAT MUTATIONS (TRE) • Trinucleotide (repeats of a particular 3 bases) sequences occur in many normal human genes • One kind of mutation known as trinucleotide repeat expansion (TRE) involves additional repeats of these sequences and is the cause of several inherited conditions including: • Biozone pg 268 • Quick Check pg 28-29

34. CODING & FLANKING REGIONS • The part of a gene that contains the coded information for making protein is called the coding regionof a gene. • The regions of either side of the coding region are called flanking regions. • The FR to the left of the CR is called the ‘Upstream Region’ and to the right is the ‘Downstream Region’.

35. CODING REGION: EXONS & INTRONS • Each segment of the coding region of a gene is called an exon. • Exons are surrounded either side by lengths of DNA that do not relate to the protein chain. • These non coding segments are called introns.

36. GENETIC MATERIAL - REVIEW • Quick Check Questions 30-31 p376 • Biochallenge – Exploring Human Genes p379 • Chapter Review Questions p380 • Key Words (Add to Glossary) • Questions 2-14 p380