1 / 12

Covariance in RNA

1 72. " ". Covariance in RNA. ref. Covariance. T y C. anticodon. 3’acc. D-stem. M ij = S fx i x j log 2 [fx i x j /(fx i fx j )] M=0 to 2 bits; x=base type x i x j see Durbin et al p. 266-8. Mutual Information. A CUUA U M 1,6 = S = fAU log 2 [fAU/(fA*fU)]...

bhelms
Download Presentation

Covariance in RNA

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. 1 72 " " Covariance in RNA ref

  2. Covariance TyC anticodon 3’acc D-stem Mij= Sfxixjlog2[fxixj/(fxifxj)] M=0 to 2 bits; x=base type xixjsee Durbin et al p. 266-8.

  3. Mutual Information ACUUAU M1,6= S = fAU log2[fAU/(fA*fU)]... CCUUAGx1x6 GCUUGC =4*.25log2[.25/(.25*.25)]=2 UCUUGA i=1j=6M1,2= 4*.25log2[.25/(.25*1)]=0 Mij= Sfxixjlog2[fxixj/(fxifxj)] M=0 to 2 bits; x=base type xixjsee Durbin et al p. 266-8. See Shannon entropy, multinomial Grendar

  4. Covariance in lab evolution Second Passage First Passage trp/tyrA pair of genomes shows the best co-growth Reppas, Lin & Church ; Shendure et al. Accurate Multiplex Polony Sequencing of an Evolved Bacterial Genome(2005) Science 309:1728

  5. Sequence monitoring of evolution(optimize transport & drug resistance) Sequence Reppas, Lin & Church

  6. Co-evolution of mutual biosensors/biosynthesissequenced across time & within each time-point Independent lines of TrpD & TyrD co-culture 5 OmpF: (pore: large,hydrophilic > small) 42R-> G,L,C, 113 D->V, 117 E->A 2 Promoter: (cis-regulator) -12A->C, -35 C->A 5 Lrp: (trans-regulator) 1bD, 9bD, 8bD, IS2 insert, R->L in DBD. Heterogeneity within each time-point . Shendure J, Porreca GJ, et al. 2005. Accurate multiplex polony sequencing of an evolved bacterial genome. Science 309: 1728-32

  7. Flux ratios at each branch point yields optimal polymer composition for replication x,y are two of the 100s of flux dimensions

  8. Non-optimal evolves to optimal Ibarra et al.Nature. 2002 Nov 14;420(6912):186-9. Escherichia coli K-12 undergoes adaptive evolution to achieve in silico predicted optimal growth.

  9. Comparative genome sequencing of E. coli allows observation of bacterial evolution on a laboratory timescale. Herring et al 2006 Nat. Gen 38:1406

  10. The Amino-acid Mutational Spectrum of Human Genetic Disease. Vitkup,D, Sander,C, Church,GM (2003) Genome Biol. 4: R72.

  11. Prediction of deleterious human alleles Shamil Sunyaev, Vasily Ramensky, Ina Koch, Warren Lathe III, Alexey S. Kondrashov, and Peer Bork Hum Mol Genet (2001) 10: 591-597 http://genetics.bwh.harvard.edu/pph/ http://polydoms.cchmc.org/polydoms/

  12. Prediction Puzzles >example1 CACCCTCGCCAGTTACGAGCTGCCGAGCCGCTTCCTAGGCTCTCTGCGAATACGGACACG CATGCCACCCACAACAACTTTTTAAAAGAATCAGACGTGTGAAGGATTCTATTCGAATTA CTTCTGCTCTCTGCTTTTATCACTTCACTGTGGGTCTGGGCGCGGGCTTTCTGCCAGCTC CGCGGACGCTGCCTTCGTCCAGCCGCAGAGGCCCCGCGGTCAGGGTCCCGCGTGCGGGGT ACCGGGGGCAGAACCAGCGCGTGACCGGGGTCCGCGGTGCCGCAACGCCCCGGGTCTGCG CAGAGGCCCCTGCAGTCCCTGCCCGGCCCAGTCCGAGCTTCCCGGGCGGGCCCCCAGTCC GGCGATTTGCAGGAACTTTCCCCGGCGCTCCCACGCGAAGC

More Related